1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
2 years ago
5

Water bends light. This type of bending is called refraction. The drawing tool shows a penny submerged in water, but only part o

f the path of the light ray is shown. How could the light ray bend as it enters and leaves the water so that you can see the penny at position B? Draw the missing parts of the light ray so the penny is visible at position B.​

Biology
1 answer:
dem82 [27]2 years ago
7 0

The water bends everyone's path into a normal line drawn perpendicular to the shoreline, as the people still on the shore are bent farther away from the shoreline than those in the water.

The same thing happens to a ray of light as it moves from air to water, or from a fast medium to a slow

one: it bends toward the normal.

Light does just that when moving between media. It takes the path that takes the least amount of time when you consider the difference in speed between the media.

For example, imagine you are looking out the window. You have air, glass, and then air again. Glass is denser than air, so light from the outside travels from a fast medium, through a slow medium, and back into a fast medium. The light takes its way from the outside to your eye, which spends the least time

learn more about refraction below

https://brainly.in/question/1651781

#SPJ10

You might be interested in
What would most likely happen if the ribosomes in a cell were not functioning?
LiRa [457]
Protein would not be made. Like the above answer, the poor little cell would die.
4 0
3 years ago
Materials that are too large to be actively transported by carrier proteins exit a cell by:
Savatey [412]
The answer is through facilitated diffusion. It is then called as the transport of substances in a biological membrane from a higher concentration to a lower concentration area though carrier proteins. Hope this is the right answer and would be of help.
8 0
3 years ago
Read 2 more answers
Chemically speaking, enzymes are composed of chains of _________________, and they are considered to be a type of ______________
Zarrin [17]
Chemically speaking, enzymes are composed of chains of amino acids, and they are considered to be a type of protein.
6 0
3 years ago
¿Durante qué fase de la mitosis se dividen los
muminat

Answer:

La respuesta es durante la anafase.

Explanation:

Espero que esto ayude a marcar el MÁS CEREBRAL !!!

8 0
3 years ago
_____ provide defense against viruses, abnormal cells, and other intercellular pathogens.
sergeinik [125]
Cell-mediated immunity <span>provides defense against viruses, abnormal cells, and other intercellular pathogens.</span>
7 0
3 years ago
Other questions:
  • What happens when a piece of glass is exposed to intense heat?
    15·2 answers
  • Nicotine acts through which nuerotransmitter in the brain? how does it interact with this nuerotransmitter?
    7·1 answer
  • Fishermen often claim that fish are more likely to strike at bait when it is raining because the fish react to the raindrops on
    12·1 answer
  • All of the big 5 extinctions occurred during the?
    14·1 answer
  • About 8% of blood plasma consists of what
    15·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Olivia researched insects that destroy farmers’ crops. Based on this information, she discovered a way to keep the insects away
    14·2 answers
  • What is an electron?
    11·1 answer
  • What do deep roots do for the plant
    5·2 answers
  • 2. Tectonic plates can collide to form (Choice 1), subduct to form (Choice 2), and even separate to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!