1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alina [70]
2 years ago
7

A section of DNA is shown.

Biology
1 answer:
iren [92.7K]2 years ago
4 0
The correct answer is D.
You might be interested in
A scientist who studies the glacier worm mesenchytraeus solifugus
Drupady [299]
He studies geosphere and biosphere.

7 0
2 years ago
What is the partially shaded outer region of shadow cast by the earth or moon called?
Neporo4naja [7]

Answer:

Penumbra I believe

8 0
2 years ago
Read 2 more answers
Que contiene el condón?
victus00 [196]

Answer:

plss translate it in English so i Can easyly answer it.

Explanation:

Thank you.

7 0
2 years ago
Which nutrient is responsible for causing the most accidental deaths in children?
Stels [109]
The nutrient that is responsible for causing most accidental deaths in children is iron.
6 0
3 years ago
What are the names of the three roles in an ecosystem?
aev [14]
Primary producers, consumers, decomposers.
4 0
2 years ago
Other questions:
  • What 5 conditions are necessary to maintain genetic equilibrium
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • If one were to argue that World War II was the most prolific time for agricultural research and development, which of the follow
    8·1 answer
  • Of cells is one of the processes that help multicellular organisms maintain homeostasis
    11·1 answer
  • Viscous fiber helps to lower blood cholesterol levels by interfering with the reabsorption of ________ in the intestines.
    6·1 answer
  • Sponges have flagellated cells called _____ that line their internal chambers and create water flow to capture food
    5·2 answers
  • How much guanine is in a salmon
    14·1 answer
  • T or F? A light year is a measure TIME on an astronomical scale.
    7·1 answer
  • Every plant has structures that function to help the plants survive. How does phototropism help a plant to survive.
    8·1 answer
  • in a further experiment , the researchers add a compound to the cell growth medium that both binds and releases protons and also
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!