1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ray Of Light [21]
2 years ago
15

Pls help, I’ll appreciate If you do

Chemistry
1 answer:
Alex17521 [72]2 years ago
3 0

The reaction that will result in a decrease in entropy is:

  • N₂(g) + 3H₂(g) → 2NH3(g).

<h3>What is entropy of a substance?</h3>

Entropy is a measure of the degree of randomness of a substance.

An increase in entropy means an increase in disorderliness whereas a decrease in entropy means an increase in orderliness.

A change of state from gas to liquid or gas to solid or liquid to solid means a decrease in entropy value.

Also, a decrease in the moles of a gas after a reaction means a decrease in entropy.

Therefore, the reaction that will result in a decrease in entropy is:

N₂(g) + 3H₂(g) → 2NH3(g).

Learn more about entropy at: brainly.com/question/419265

#SPJ1

You might be interested in
1. Carbon12 is C. How many atoms of carbon 12 are there in one mole of<br> carbon 12?
Dvinal [7]

Answer:

the answer is 12.01 mole

7 0
3 years ago
What is the main idea of the article, "Great Wall of China"?
grin007 [14]

well, without the article, I'm guessing the main idea is about the Great Wall of China

7 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
(e) A 0.050 mol sample of a hydrocarbon was burned in excess oxygen.
LenKa [72]

The correct answer is 0.15.

We are aware that there is 0.05 mol of an unidentified hydrocarbon we will refer to as "X" and that its burning produces 6.6 g of carbon dioxide and 3.6 g of water.

These quantities might be converted to moles by applying the following formula:

amount= mass/ relative atomic mass

Thus, the following equation may be written for H2O: moles = 3.6 / 18 = 0.2 and for CO2: moles = 6.6 / 44 = 0.15.

0.05X + x'O2 = 0.15CO2 + 0.2H2O

This may be made simpler by dividing through by 0.05 (this step is likely to be the most helpful to you), resulting in:

1 x + x O2 = 3 co2 + 4 H2O

The hydrocarbon must have been the source of all the carbon in the carbon dioxide and all the hydrogen in the water.

Accordingly, 4 x 2 = 8 moles of H and 3 x 1 = 3 moles of C.

There are 3/1 = 3 Cs and 8/1 = 8 Hs in one X molecule.

This clearly identifies C3H8 or propane as the hydrocarbon X (dividing by 1 seems unnecessary, but it illustrates the process to use if there were more than one mol of X in the first equation).

To learn more about number of moles of carbon dioxide refer the link:

brainly.com/question/12723070

#SPJ9

6 0
2 years ago
I will reward Brainly
riadik2000 [5.3K]
Eczema is a type of allergy or bacterial infection.

If this helps please mark Brainliest.
8 0
3 years ago
Read 2 more answers
Other questions:
  • 5.77 rounded to 1 dig digit
    6·1 answer
  • 1. which compound has the highest boiling point ?<br> A) C6H12O6<br> B) O2<br> C) H2O<br> D)NaCl
    15·1 answer
  • What is the main difference between protons and neutrons
    6·2 answers
  • Explain why a fluorescent light bulb is not as hot as an incandescent light bulb.
    13·2 answers
  • What is the maximum mass of pure gold that could be extracted from 3.0kg of calaverite, a gold ore with the chemical formula AuT
    9·1 answer
  • Which of the following has the most kinetic energy?
    8·2 answers
  • What is mass in grams of 2.30 moles of Aluminum?
    5·1 answer
  • Read the Safety Data Sheet of hydrogen peroxide to identify the recommended way to store this substance. Choose one:_______.
    5·1 answer
  • Which energy resource produces the least amount of air pollution?.
    5·1 answer
  • The empirical formula for a compound is C3H3O the molecular mass is 110 what is its molecular formula
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!