1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotykmax [81]
3 years ago
10

Description of human trafficking from 2016 to 2019 in communities ​

Biology
1 answer:
mezya [45]3 years ago
8 0
Human trafficking has shown a record-high number of cases during the year 2016.the number number of cases recorded in 2016 had jumped to over 25,000
You might be interested in
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
If a factor is dynamic, what does that mean? ​
V125BC [204]

Answer:

In econometrics, a dynamic factor (also known as a diffusion index) is a series which measures the co-movement of many time series. It is used in certain macroeconomic models.

Explanation:

4 0
1 year ago
Read 2 more answers
Some bacterial cells live in very cold environments (such as the arctic ocean), but they still require membrane fluidity like th
Dima020 [189]

Answer and explanation;

-Arctic microbes would have membranes with more unsaturated fatty acids; increasing the unsaturated fatty acid ratio would make it harder for the fatty acids to pack together. This will keep the membrane fluid at lower temperatures, which will benefit organisms that live in very cold climates.

-Microorganisms are adapted for optimum functioning in their normal physiological environments. Any extreme change in environmental conditions from the optimum inflicts a stress on an organism. For this reason they must accommodate a variety of changing conditions and stresses in their environment in order to survive and multiply.

3 0
3 years ago
WHAT IS TRUE ABOUT CELL PARTICLES PLEASEEEE HELPPPP
Tcecarenko [31]

Answer:

D

Explanation:

Particles move from a region of higher concentration to a region of lower concentration until the molecules are evenly contributed

4 0
3 years ago
What is the hierarchy<br> of living things
Licemer1 [7]

Answer:

Organelles, cells, tissues, organs, organ systems, organisms, populations, communities, ecosystems, and biosphere are the biological stages of organization of living things, organized from the simplest to the most complex.

Explanation:

6 0
3 years ago
Other questions:
  • A woman at 22 weeks' gestation has right upper quadrant pain radiating to her back. she rates the pain as 9 on a scale of 1 to 1
    13·1 answer
  • Researchers create a recombinant DNA molecule in which the coding sequence for GFP is inserted downstream of the enhancer/promot
    10·1 answer
  • when biologists wish to study the internal ultrastructure of cells, they can achieve the finest resolution by using a
    12·1 answer
  • Mycelia produced in asexual reproduction are _____.
    10·1 answer
  • bacteria that feed off of food in human gut and provide essential nutrients to their host are an example of
    10·2 answers
  • How do only certain cells respond to particular signaling molecules that may be sent throughout the body?
    5·1 answer
  • Which are characteristics of eukaryotic organisms? PLZ HELPP
    10·1 answer
  • Which of the cell types shown is most associated with the production and flow of cerebrospinal fluid (CSF)?
    12·1 answer
  • What does the Golgi body do?
    12·1 answer
  • Which blood pressure reading is taken when the heart contracts?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!