1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
2 years ago
8

Which characteristic most likely describes a mushroom but not Thermus aquaticus?

Biology
1 answer:
Lunna [17]2 years ago
4 0

Eukaryotic is the characteristic most likely describes a mushroom but not Thermus aquaticus.

<h3>Mushroom belongs to which domain?</h3>

Any member of the eukaryotic group of organisms, which also includes the more well-known mushrooms and microbes like yeast and mold, is referred to as a fungus.

One of numerous thermophilic bacterial species that are a part of the Deinococcota phylum that can withstand high temperatures is Thermus aquaticus. Bacteria are classified as prokaryotes, which are unicellular life forms. Prokaryotes lack a membrane-bound nucleus and other internal components.

For more information regarding prokaryotes, visit:

brainly.com/question/1288013

#SPJ1

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
The full extent of my __________ skill is preparing scrambled eggs on toast.
olga nikolaevna [1]
The answer is culinary. Hope this helps.
3 0
3 years ago
What do i do to comfort my sister who is going through her first period.
TEA [102]
If she has cramps Dark chocolate helps with that.But just give her advise on some things.Tell her it gets better and its just part of life.
3 0
3 years ago
Read 2 more answers
About how many years old is earth
Serjik [45]

The Earth is around 4.6 billion years old. Earth has a slightly squashed sphere, measuring 7,973 miles (12,756 km) in the diameter at the equator.

5 0
3 years ago
You breed a plant that has purple flowers with a plant that has orange flowers and the resulting offspring has purple and orange
gayaneshka [121]

Answer:

Incomplete dominance

Explanation:

Incomplete dominance is the expression of phenotype of two paired alleles (i.e dominant and recessive allele) all together.

Usually when two alleles get paired, the characteristics of the dominant allele is expressed while the characteristics associated with recessive alleles are expressed only when the two recessive allele get paired.

Here in this case the characteristics of both type of allele are expressed i.e. both orange and purple strips appear in the offspring. Hence, this case shows the incomplete dominance.

5 0
3 years ago
Other questions:
  • The study of living things and their environment is called<br> What is it
    9·2 answers
  • What was produced by the enzymatic reaction studied in our lab?
    14·1 answer
  • The tissue in the wall of the heart contracts
    5·1 answer
  • Why is using kilometers a problem in space
    14·2 answers
  • Which blood vessels will have walls only one cell thick?
    9·1 answer
  • Which of these are more likely to occur along a transform boundary
    10·2 answers
  • A cell membrane has a double layer of molecules. These molecules are made up of a phosphorus-containing “head” and two long, fat
    13·1 answer
  • Knowing the epidemiology and causative agent of Legionaries disease what questions would you ask of the victims or of their surv
    11·1 answer
  • Darwin visited the Galapagos Islands while on a journey aboard the Beagle. Which observation led Darwin to start thinking about
    14·1 answer
  • What are 4 cellular activities that would require the energy of ATP?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!