1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LUCKY_DIMON [66]
2 years ago
13

Where is the nucleus usually located?

Biology
2 answers:
Nady [450]2 years ago
6 0

Answer:

B

Explanation:

usually in the center . depends on what cell prokaryotic or eu

LuckyWell [14K]2 years ago
5 0
In the center of the cell
You might be interested in
Can someone match them? ALL FOR BRAIN LIEST TY!! :D
Verdich [7]

Answer:

1: D

2: C

3: G

4: A

5: E

6: I

7: F

8: H

9: B

4 0
3 years ago
What is the difference between a heart and a brain?
patriot [66]
Brain controls nerves

Heart pumps the blood
4 0
3 years ago
Read 2 more answers
Chickens as Drug Factories
PolarNik [594]
Well to begin with this process is called genetic engineering, the scientists altered the DNA of the chickens instead of altering a protein already in the chickens because when you alter the DNA the offsprings  of the chicken will will have the same qualities while if you only alter the protein already in that chicken only that chicken will be able to do the job 
6 0
3 years ago
What is an important trait or skill for a scientist to have?
puteri [66]
Hi!

The answer is "avoidance of bias"

Hope this helps!

-Payshence xoxo
8 0
3 years ago
Read 2 more answers
What are the three chemical molecules that make up the subunits of DNA?<br><br> a, b, c, or d?
lana [24]

Answer:

A

Explanation:

This is because those items are the actual required ones when it comes to building the molecule DNA.

8 0
3 years ago
Other questions:
  • Which of the following plant systems is most like the cardiovascular system in animals?
    10·2 answers
  • What is one effect of a fever?
    15·1 answer
  • Describe how the central nervous system differs from the autonomic nervous system.
    12·2 answers
  • Which do guard cells control?
    15·2 answers
  • A bird is flying in the air at a 4 m/s. If the mass of the bird is 7kg what is it’s kinetic energy
    8·2 answers
  • 8. About how many chloroplasts can be found in photosynthetic cells?
    8·2 answers
  • Making vegetable portions on your dinner plate twice the size of your meat portion would be a great strategy to
    5·1 answer
  • Which statement about mitosis is true? (brainliest)(15points)
    8·2 answers
  • In Griffith's transformation experiments, the S and R strains of bacteria were _____ and _____ in nature, respectively.
    12·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!