1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
e-lub [12.9K]
3 years ago
7

How to calculate average molarity​

Biology
1 answer:
avanturin [10]3 years ago
6 0

Answer:

To calculate the molarity of a solution, you divide the moles of solute by the volume of the solution expressed in liters.

Explanation:

The molarity (M) of a solution is the number of moles of solute dissolved in one liter of solution. To calculate the molarity of a solution, you divide the moles of solute by the volume of the solution expressed in liters.

You might be interested in
Name 7 pieces of evidence for evolution and describe each how do I answer this?
s2008m [1.1K]
Evolution:

. Natural selection

. prehistoric times

. fossils

. certain body parts

. animals that are different but have similar traits

7 0
3 years ago
How are digitized signals sent?
Bezzdna [24]

Answer:

Digital and analog signals are transmitted through electromagnetic waves. Changes in frequency and amplitude create the music you listen to or images that you see on a screen. Analog signals are composed of continuous waves that can have any values for frequency and amplitude.

7 0
2 years ago
Producers uke this plant take in oxygen and release carbon dioxide during
sweet-ann [11.9K]

Answer:

I think B)

Explanation:

What your asking isn't that clear but if you said 'producers' is a kind of plant that creates their own food and the process is called photosynthesis.

But at the same time your question says "this plant take in oxygen and release carbon dioxide during  just like animals and other living things" Im not sure that plants are the ones to take in oxygen and release carbon dioxide so....

I'm sorry if this didn't answer your question.

7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Scientists are studying a group of living cells under a microscope. They write down notes about the size, shape, and color of th
astra-53 [7]

Answer:

This experiment is a phenotypic characterization of the cells that are being investigated .

Explanation:

This type of experiment may result useful to understand how cell traits (i.e., cellular phenotypes) are associated with a genotype and different environmental conditions.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Can you help me please I’ll give you a Brainly list and it’s science
    11·2 answers
  • What is it called when a molecule moves across a semipermeable membrane into a region of higher concentration?
    9·2 answers
  • ????????????????????????
    11·1 answer
  • The transition of light colored moths in an original population into dark colored moths after natural selection occurs is a clas
    5·1 answer
  • Will upvote:
    12·1 answer
  • A horse has 64 chromosomes and a donkey has 62. Using your knowledge of meiosis, explain why a cross between a horse and a donke
    10·1 answer
  • A farmer has decided to dig an artesian well into the unconfined aquifer below his crops.
    12·1 answer
  • What is the flow of molecules in active transport?
    7·1 answer
  • Which of the following materials would allow the flow of electricity?
    8·2 answers
  • Why does the ocean heat and cool more slowly than the atmosphere?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!