1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
2 years ago
11

How do mutations affect evolution?​

Biology
2 answers:
3241004551 [841]2 years ago
6 0
They increase genetic variation.
Alinara [238K]2 years ago
5 0

Answer:

Mutations affect evolution by increasing genetic variation and the potential for individuals to differ.

You might be interested in
Why pollen is important in fertilization?
alexandr402 [8]

Answer:

pollen is important in fertilization because pollen carries male gamete and it helps in transportation of male gamete during fertilization in mainly gymnosperms and angiosperms.

3 0
3 years ago
PLEASE HELP ME!!!!!!!
Minchanka [31]

Answer:

1= full moon

2=waning gibbous

3=last quarter

4=waning crescent

5=new moon

6=waxing crescent

7=first quarter

8=waxing gibbous

3 0
3 years ago
Read 2 more answers
An experiment is designed to determine if wheat grows better when it is planted alone or with clover. The design calls for 3 pan
Viktor [21]

Answer: Option B

Explanation:

Usually in scientific experiments, at least one parameter is checked; here, the growth rate of wheat in two different conditions is being evaluated.

Hence, growth rate of wheat alone in pans A, B and C becomes the standard or referential control against which the experimental control (Wheat + clover) in pans D, E and F is evaluated, since both treatments are exposed to the same external conditions.

I hope this helps

4 0
3 years ago
Whats the relationship between DNA,chromosomes,and genes?
Elina [12.6K]
DNA is a chain of nucleotides bonded together.  On that chain there are particular portions of it that the sequence of the nucleotide codes for particular proteins; this is known as a gene.  In eukaryotric cells, DNA is coiled around proteins such as histones to form chromatids which when two join at the centre by a centromere to form a chromosome.
6 0
3 years ago
A pig that has a curly tail (he is heterozygous for this trait) mates with a pig that has a straight tail. Curly tails are domin
Aleks [24]

Answer:

Curly?

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • In the Galapagos Island finches, the variation in the beak shape corresponded to which finch characteristic?
    11·2 answers
  • What is the common name of this gas, N2, the most prevalent in our atmosphere? A) sodium B) nickel C) nitrogen D) oxygen
    13·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • 1. Ramachandran wants to understand brain functioning. How does he believe that we can better understand how the brain functions
    14·1 answer
  • The female reproductive system in humans differs from the human male reproductive system in that only the female system is respo
    15·2 answers
  • How does the structure of phylogeny charts explain homologous structures in organisms?
    6·2 answers
  • How are control and variable related
    5·1 answer
  • Which of these plant parts would most likely have the largest number of chloroplasts?
    12·1 answer
  • What do these two changes have in common?
    9·2 answers
  • 21. The diagram below represents a sequence of events that occurs in living things.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!