1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetlanka [38]
2 years ago
6

5. Design an experiment that

Biology
1 answer:
notsponge [240]2 years ago
3 0

Explanation: this experiment is long term which means patience is compulsory. you need to have a wild sloth and a domesticated sloth adopted right at their birth (he should be in a controlled environment that mimics the wild). your domesticated sloth shouldn't have the algae. at their middle age, you should compare them with them from every aspect.

You might be interested in
In a crime scene, what would you place clothing with blood on it in found as evidence? And why?
Andrej [43]

Answer:

A plastic bag because the others would ruin the evidence the cotton would absorb the blood same with the envelope , paper bag.

Explanation:

6 0
2 years ago
Which drug would be used to treat a client with severe motor tics, barking cries, and outbursts of obscene language?
Volgvan
Clonidine Off Label that patient has Tourette's Syndrome
6 0
2 years ago
Read 2 more answers
Hepaticophytes lack stomata and tracheids. What would provide evidence to justify their inclusion in the Bryophytes and not the
tatyana61 [14]

Answer:

The characteristics that define liver diseases within bryophytes are:

They are terrestrial plants unlike Charophytes that are aquatic.

There is development of an embryo that gives rise to a diploid multicellular sporophyte.

3 0
3 years ago
What is a vacuole?? and what does it do??
Serjik [45]
The vacuole is a "container" in the cytoplasm in a cell that stores water, food, and waste.

4 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
Other questions:
  • Copper wires used to connect circuits in microprocessors (computer chips) are deposited by passing electrical current through a
    10·1 answer
  • suppose a shopping mall is built near a rabbit warren, leaving less land available for rabbits how will this affect the environm
    9·1 answer
  • One major problem with the human-induced stress on ecosystems is that: newly introduced species almost never thrive in unfamilia
    7·1 answer
  • What is the difference between accurate data and reproducible data?
    6·2 answers
  • Which one of the following statements is true of enzyme catalysts? A) Their catalytic activity is independent of pH. B) They are
    6·1 answer
  • When a disaccharide is formed, how many water molecules are formed.
    10·1 answer
  • Name some harmful substances found in cigarette smoke. How do these
    14·1 answer
  • PLEASE ANSWER FAST!!!
    7·2 answers
  • Explain natural selection using the finches as an<br> example.
    8·1 answer
  • Plz help me I am timed
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!