1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
2 years ago
5

Which of these rights can be found in the victims' rights laws of most jurisdictions?

Law
1 answer:
Jlenok [28]2 years ago
6 0
18th adment. its to keep the right to silnce
You might be interested in
12. Which Founding Father appointed John Marshall as a Supreme Court Chief Justice?
notsponge [240]
John Adams appointed Marshall as a Supreme Court Chief Justice
3 0
3 years ago
1. Which type of newspaper article would be treated as a secondary source, even if it was written near the same time as the even
nirvana33 [79]
4 articles from the arts and culture section
8 0
3 years ago
How do u use the 5 commandment in court
avanturin [10]
Freedom to press can be useful as can freedom to remain silent and innocent until proven guilty they have to prove your guilty not prove your innocents
8 0
3 years ago
John walks into a grocery store and suddenly realizes that the prices on most of his favorite imported
harina [27]

Answer:

A

Explanation:

6 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • when exiting the expressway, the de acceleration lane may be short, requiring you to _____________ quickly
    8·1 answer
  • The scope of authority and power held by an agency is called____.
    11·1 answer
  • Which of the following is an insanity defense?
    12·1 answer
  • Obsesion... Frankie J<br> on repeat baby... over but never forgotten<br> but it was just an illusion
    9·1 answer
  • A difference between a trespass and a conversion is a matter of
    11·1 answer
  • An attorney who wishes to exclude a juror because of a predjudice makes a
    12·1 answer
  • Status offenses are a second classification of youthful offender also known as wayward minors. A status offender is a child subj
    12·1 answer
  • What is one of the disadvantages of getting a government-sponsored mortgage?
    11·1 answer
  • What is a public opinion poll
    8·2 answers
  • Which amendment guarantees a trial by jury if accused of a crime?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!