1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
2 years ago
5

Provide practical examples of passive (natural and artificial) and active (natural and artificial) immunities?

Biology
1 answer:
Tems11 [23]2 years ago
3 0

Answer:

How many countries are the original members

You might be interested in
What effect does a keystone predator have on its habitat?
nikklg [1K]
The answer is B

A keystone predator would increase niche diversity and help reduce niche competition  <span />
7 0
3 years ago
Read 2 more answers
Study this image of space. A cloud of gas and dust. What object is shown in this image? a nebula a red giant a supernova a neutr
zubka84 [21]

Answer: The image to be studied is missing from the question,so I attached it to my answer,please click on the attachment provided to view the image being studied.

The correct answer to the question is option A.

NEBULA

The object shown in the image is known as a nebula.

Explanation: A nebula is found in interstellar space,it has a form of a giant cloud of dust. When some stars goes into dying process,they explode throwing out gas and dust which forms a nebula.(a supernova remnants nebulae).

Some nebulae(singular form of nebula) are also found where new stars are being formed.

Nebula are the basic building blocks of the universe,they are made up 90% hydrogen,10% helium and other heavier elements in trace amounts from which stars and other solar systems are made.

Nebula exist in 5 distinct types namely;

Emission nebulae, Reflection nebulae,Dark nebulae, Planetary Nebulae and supernova remnants Nebulae.

4 0
3 years ago
Plants are designed to convert solar energy into usable chemical energy via the process of photosynthesis. As a result, plant ti
dexar [7]

The anser is D) Plastids in roots cells are large and designed to store water for later use.

7 0
2 years ago
Read 2 more answers
Greg is telling his teacher how a cell is like a house. Which part of a cell is like the air in Greg's house?
NISA [10]
The air in Greg's house is like the cytoplasm of a cell because it is the gel-like material that surrounds the other parts of the cell. 
Hope this helps! :) 
8 0
3 years ago
What are the special features of a sperm cell
Airida [17]
<span>Long tail for swimming
<span>Head for getting into the female cell

Hope this helps you ! :') </span></span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • List some general characteristics of producers and list a few examples.
    9·1 answer
  • Corals are polyps of coelenterates (cnidarians) that contain numerous algae in their tissues. the algae contain photopigments th
    14·1 answer
  • The image displays the embryological development of five groups of vertebrates. Based on the evidence illustrated in the image,
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the following is caused by pollutants from farm runoff, feedlots, or septic tanks? . . Increased fecal coliform . . Low
    15·2 answers
  • Hemoglobin and hair are both proteins,yet they have different structures. Explain
    13·2 answers
  • Interogenes are genes that cause a cell to continuously divide. These genes are usually targeted by doctors who are trying to st
    14·1 answer
  • Large molecules enter the cell by endocytosis and exit the cell by exocytosis. Structure “A” facilitates, or helps, the diffusio
    9·2 answers
  • An airplane flying at a velocity of 610 m/s lands and comes to a complete stop over a 53 second period. a. Did this airplane spe
    15·2 answers
  • 11. The image below shows what happens when cold medicine tablets are placed in room-temperature
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!