1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesnalui [34]
4 years ago
5

A big advantage of sexual reproduction is _________ variability in the offspring.

Biology
2 answers:
Oksanka [162]4 years ago
7 0

The correct answer is option B

A big advantage of the sexual reproduction is the genetic variability in the offspring.

In case of sexual reproduction every individual is different and this the biggest advantage of sexual reproduction over asexual reproduction.

The variation in the species increases the chances of survival. Some might survive in the extreme situations and some might not. This is due to the genetic variability in individuals.

Lelechka [254]4 years ago
6 0
Genetic is the answer I THINK.
You might be interested in
Which of these events occurs during metaphase? chromosomes coil and condense centromeres separate chromosomes migrate to equator
zheka24 [161]
The chromosomes migrate to the equator of the spindle apparatus, they line up in the middle. meta means middle
4 0
3 years ago
PLEASE HELP!!!! WILL GIVE BRAINLIEST!!!!!!
mrs_skeptik [129]

Answer:Nucleotide

A nucleotide consists of a sugar molecule

5 0
3 years ago
An organism is resistant to a chemical if it __________. did not eat anything with the chemical on it has been exposed to a smal
Dafna11 [192]

an organism is resistant to a chemical if it has a gene that protects it from the chemical.

8 0
3 years ago
On the lines provided, enter the name of the target organ(s) affected by the pituitary hormone indicated. Hypothalamic nerve cal
Dennis_Churaev [7]

Produced by the anterior pituitary. It's regarded as a tropical hormone. Target cells are impacted by tropical hormones indirectly after being stimulated.

<h3>The anterior pituitary gland affects which organs?</h3>

The following organs, glands, and bodily tissues are affected by and interact with the anterior pituitary hormones: organs, muscles, and bones the growth hormone (GH). Adrenocorticotropic hormone: Adrenal gland (ACTH). thyroid hormone, which stimulates the thyroid gland (TSH).

<h3>What are the anterior pituitary gland's seven hormones?</h3>

Frontal pituitary

hormone adrenocorticotrophic (ACTH)

hormone that stimulates the thyroid (TSH)

Luteinizing agent (LH)

hormone that stimulates ovulation (FSH)

Prolactin (PRL) (PRL)

hormonal growth (GH)

MSH, or melanocytic-stimulating hormone

Because it releases hormones that regulate the thyroid, adrenal glands, ovaries, and testes, the pituitary gland is frequently referred to as the "master gland."

To know more about pituitary hormone visit :-

brainly.com/question/13260616

#SPJ4

8 0
1 year ago
bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb
yanalaym [24]
Cccccccccccccccccccccccccccccccccccccccccccccc
5 0
2 years ago
Read 2 more answers
Other questions:
  • As part of their normal function, many proteins bind to DNA briefly and then release it again. Which types of bonds might be inv
    10·2 answers
  • CROSSWORD PUZZLE: A specific product of a drug, formed by the chemical processes in the body that break down the drug (10 letter
    7·1 answer
  • Answer asap!!!
    5·2 answers
  • What organism provides energy to the grasshopper? Which one provides energy to the hawk?
    14·1 answer
  • All BUT one of these occur during metaphase I of meiosis. Which of these would NOT occur during the metaphase I phase of meiosis
    10·2 answers
  • State Road 40 and several other roads run through the Ocala National Forest. For several years, forest rangers collected data sh
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following ratios in a circle is equal to π?
    7·2 answers
  • Answer #14 and will mark brainliest
    7·1 answer
  • Two atoms of uranium that differ in their numbers of neutrons are called
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!