1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
2 years ago
5

What are the products of Anaerobic Respiration in yeast?

Biology
1 answer:
8090 [49]2 years ago
3 0

The products of anaerobic respiration in yeast are carbon dioxide and ethanol.

<h3>Anaerobic respiration</h3>

This refers to respiration in the absence of oxygen.

In the absence of oxygen, both the citric acid cycle and the electron transport chain cannot proceed. Thus, only glycolysis takes place.

The two pyruvate molecules produced in anaerobic respiration in yeast are converted to ethanol, instead.

More on anaerobic respiration can be found here: brainly.com/question/12605249

#SPJ12

You might be interested in
if the co2 level in blood rises above a preset limit, how will the respiratory center adjust the breathing to compensate?
Gekata [30.6K]
If you have too much CO2 in your blood, you will hyperventilate (or breath faster) to get rid of the CO2 and get more oxygen


4 0
3 years ago
What part of the data validates their conclusion
tekilochka [14]
Evidence validates conclusion
3 0
4 years ago
Whether a mutation is harmful or helpful depends partly on an organism's _________.
Ber [7]
Traits? maybe?

Organisms are often mutated / genetically modified to produce a new organism with the best of both traits. 

hope this helps.
5 0
4 years ago
For the following question, match the key event of meiosis with the stages listed below.I. Prophase I V. Prophase IIII. Metaphas
Airida [17]

Answer:

B (Metaphase I)

Explanation:

Meiosis is one of the two types of cell divisions that results in 4 daughter cells (gametes) with each having half the number of chromosomes as the parent cell. During meiosis, cell division occurs twice because before the separation of two halves of a duplicated chromosome called sister chromatids, there still need to be separation of homologous pairs, which is a similar but non-identical pair of chromosome received from both parents. Hence, meiosis occurs in a two step division process; meiosis I and meiosis II.

During Prophase I, which is the first stage of meiosis I, homologous chromosomes pair up side by side to form a structure called TETRAD or BIVALENT and likely undergo crossing over( when segments of homologous chromosomes get broken and refixed interchangeably).

After crossing over, the spindle fibres (from the centrosomes) begin to attach to the centromeres of each chromosomes and move them towards the center of the cell called METAPHASE PLATE. Hence, they become aligned on the equator towards either side of the pole. Each chromosome attaches to microtubules from one pole of the spindle and the two homologues of a pair bind to microtubules from opposite poles. Hence, in Metaphase I, homologous pairs, not individual chromosomes, line up at the Metaphase plate/equator for separation.

The orientation of the line up of homologous chromosomes determines which chromosomes enter into the same cell i.e. the alignment of chromosomes towards the same pole determines which chromosomes enter into the same cell to form the genetic composition of gametes. In an organism with two sets of chromosomes (diploid), there are four possible combinations in which chromosomes are arranged in the metaphase plate, resulting in differences in chromosomal distribution in daughter cells/gametes, the process of independent assortment

6 0
3 years ago
Experiments have been conducted to test if the RNA world hypothesis could be true. What are these experiments trying to determin
IgorLugansk [536]

Answer:Dna

Explanation:

This is trying to determine the DnA

8 0
3 years ago
Other questions:
  • How do bugs eat food?
    9·2 answers
  • A novel multicellular organism has been discovered whose natural habitat is a barren desert with limited water and nutrients. Th
    9·1 answer
  • Why not transfecting cells at confluency?
    10·1 answer
  • What is name for the point on the earth’s surface where the earthquake occurs?
    10·2 answers
  • What cell organelle immediately identified it as a eukaryote?
    14·1 answer
  • What is a multicellular organism? an organism that is made up of only one cell. an organism that is made up of only one type of
    6·2 answers
  • How does eating food benefit an animal?
    15·2 answers
  • A student wants to test the hypothesis that fertilizer improves the growth rate of grass seeds. To test this hypothesis, the stu
    13·1 answer
  • In the process of photosynthesis, plants produce glucose. They use some of this glucose to grow. They store the rest in fruit an
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!