1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Whitepunk [10]
2 years ago
6

Hey

Biology
1 answer:
irga5000 [103]2 years ago
3 0

Statements 1 and 4 are true, while 2 and 3 are false.

<h3>Decomposition reaction</h3>

In decomposition reactions, one or more reactants decompose to produce two or more products.

Decomposition reactions with single reactants are known as single decomposition reactions. Those with 2 reactants are known as double decomposition reactions.

Decomposition reactions do not always produce elements. It could be compounds in some cases.

Decomposition reactions always obey the law of conservation.

More on decomposition reactions can be found here: brainly.com/question/8009068

#SPJ1

You might be interested in
Which of the following is not an advantage of eukaryotic DNA over prokaryotic DNA?
Lorico [155]
Eukaryotic DNA is more likely repaired than prokaryotic DNA
5 0
3 years ago
Read 2 more answers
A 28 year old female presents with severe chest pain and shortness of breath. she is diagnosed with pulmonary embolism. which is
Anton [14]
The pulmonary embolism is due to her heart not pumping correctly
3 0
4 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Submit your project explaining your choices for each of the five scenarios presented.
slega [8]

Answer: Can you say which five scenarios is the project talking about-?

5 0
3 years ago
1. A severe weather watch means which of the following?* (
BlackZzzverrR [31]
The answer is “the conditions are right for severe weather but it is not occurring yet”
6 0
3 years ago
Other questions:
  • What carries electrical messages to the brain?
    5·1 answer
  • A diagram illustrates that grass is eaten by insects, birds, and mice. The insects are eaten by hawks, snakes, and toads. The bi
    15·2 answers
  • PLZ HELP ASAP how is the frog’s heart different from the human heart?
    8·2 answers
  • What is a hard and tough rock that contains large crystals
    12·1 answer
  • What is the difference between a cyclone and an anticyclone? *
    14·1 answer
  • Desert animals are active at night to avoid the heat.Which type of adaptation is this?
    9·1 answer
  • How can Microscopic protists and fungi be characterized
    6·1 answer
  • The nurse identifies which symptom as a manifestation of right-sided heart failure (hf)?
    6·1 answer
  • what would happen if homogenisation and pasteurisation steps are omitted during the production of yoghurt
    13·1 answer
  • What term describes the light-absorbing molecule that plants use to absorb energy?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!