1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tigry1 [53]
2 years ago
5

A molecule made primarily of amino acids with carbohydrate side chains would be described as a.

Biology
2 answers:
Talja [164]2 years ago
7 0
It’s amino acids !!!!
miskamm [114]2 years ago
5 0

Answer:

Amino Acids

Explanation:

The best way to look at it is to split it up.

Proteins are made up of many amino acids.

Amino- amine ( nitrogen) and acid ( coboxylic acid) make up amino acids

You might be interested in
Identity the object made from a nonrenewable resource,
Natasha_Volkova [10]
Answer: flowers,other minerals
8 0
3 years ago
What is the cell cycle
kogti [31]
The cell cycle, or cell-division cycle, is the series of events that take place in a cell leading to its division and duplication of its DNA (DNA replication) to produce two daughter cells.
8 0
3 years ago
Are centrioles always there? or do they only exist during mitosis
Amiraneli [1.4K]

Answer:yes they do

LOLOLOLOLOL

3 0
3 years ago
The cell membrane _____.
LekaFEV [45]
Contains and protects the cell
7 0
3 years ago
Read 2 more answers
Which leads scientists to believe that Earths inner core is solid
ELEN [110]
Waves traveling through the inner core<span> go faster than those throughthe </span>outer core<span>.</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which steps are part of the seafloor spreading process? Check all that apply. A crack forms in oceanic crust. Volcanoes erupt un
    8·2 answers
  • Scientists use specific levels of organization to analyze the biosphere. Which level of organization describes a school of ancho
    12·2 answers
  • Is a wolf a producer
    13·1 answer
  • What is the best explanation for the microvilli on the apical surface of the proximal convoluted tubule (pct)?
    9·1 answer
  • What type of fossil fuel is made from trees ferns Moss is and other marsh plants
    10·2 answers
  • What one of the following terms is used to describe a program that has been created to be used in a malicious, or hateful, way?
    9·1 answer
  • Polygenic Inheritance Please help!
    10·1 answer
  • It has been proposed that the presence of black markings on the throat of kung fu geckos is coded by a dominant allele (B) and t
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Yo Yo all Pari here✌✌
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!