1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
2 years ago
12

1. Why is Maya Lim excited about classroom bioprinters? 2. What parts of Maya Lim's job as a chemical engineer sound interesting

to you?
Biology
1 answer:
mars1129 [50]2 years ago
5 0

Classroom bioprinters can be used to print literally any biological object, whereas a chemical engineer is responsible to use chemistry to develop processes and devices.

<h3>What is a bioprinter?</h3>

A bioprinter is a device that combines cells and transcriptional growth factors, in order to generate structures similar to tissues and organs.

Moreover, a chemical engineer is aimed at exploring the chemical properties of matter to develop processes and devices.

In conclusion, classroom bioprinters can be used to print literally any biological object, whereas a chemical engineer is responsible to use chemistry to develop processes and devices.

Learn more about bioprinters here:

brainly.com/question/25468891

#SPJ1

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Progressive changes in fossils of different ages provides one of the strongest lines of evidence for
kykrilka [37]
Are there any options you can provide?
3 0
3 years ago
Give the names of two co- enzymes that take part in the cellular respiration.
olya-2409 [2.1K]

Answer:

Explanation:

Two of the most important and widespread vitamin-derived coenzymes are nicotinamide adenine dinucleotide (NAD) and coenzyme A. ... When NAD loses an electron, the low energy coenzyme called NAD+ is formed. When NAD gains an electron, a high-energy coenzyme called NADH is formed.

8 0
4 years ago
Why should we only breathe through nose
slamgirl [31]
Because it makes it easier for the air to flow through our bodies.
6 0
3 years ago
Read 2 more answers
The evidence that species change gradually over time is found in _____.
Morgarella [4.7K]
I think the answer is Evolution.


Hope this helps
3 0
3 years ago
Read 2 more answers
Other questions:
  • Ribosomal RNA is produced by (a)lysosomes (b)nucleoli (C)mitochondria (d)Golgi bodies
    6·1 answer
  • Omar wrote a hypothesis about batteries called dry cells.
    14·2 answers
  • Would remote sensing be a useful way to monitor other ecosystems on Earth? Provide evidence to support your answer.
    9·1 answer
  • All of the following affect the temperature at which magma forms except what?
    7·1 answer
  • How is the sun’s energy passed along in an ecosystem?
    15·1 answer
  • HELP QUICKLY NO LINKS I WILL REPORT
    10·1 answer
  • PLEASE HELP ASAP<br> List and describe the five steps to form sedimentary rocks.
    8·1 answer
  • The consumption of carbohydrates is most likely to:.
    8·1 answer
  • Provide an environment (bowl or container) filled with 100 of each "prey" type (Consider beans, uncooked pasta, or cotton balls)
    5·1 answer
  • What is the best choice for a blank when calibrating the spectrophotometer when you will later measure the absorbance of beverag
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!