1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveticcg [70]
2 years ago
10

A person has two genes, A and B that are on the same chromosome and 25cM apart, what percentage of their gametes would you expec

t to have parental combination of A and B
Biology
1 answer:
Bezzdna [24]2 years ago
3 0

The percentage of your gametes that are expected to have a parental combination of A and B is 25%.

<h3>Why is AB blood so rare?</h3>

Even rarer, type AB blood is characterized by the fact that it has no antibodies against either type A blood or type B blood. This means that people of this blood group can receive blood of any type without risk of adverse reactions.

With this information, we can conclude that The percentage of your gametes that are expected to have a parental combination of A and B is 25%.

Learn more about AB blood in brainly.com/question/256625

#SPJ1

You might be interested in
What happens in humans? internal vs external
Maslowich

Answer:

internal

Explanation:

5 0
3 years ago
Which component of the blood is part of the body’s immune system?
crimeas [40]

<em><u>Answer: Plasma.</u></em>

<u><em /></u>

<em><u>Explanation: Plasma is the liquid component of blood, in which the red blood cells, white blood cells, and platelets are suspended. It constitutes more than half of the blood's volume and consists mostly of water that contains dissolved salts (electrolytes) and proteins. The major protein in plasma is albumin.</u></em>

<u><em /></u>

8 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Which of the following could limit the growth of a population of squirrels in a local park?
leonid [27]

Answer:

D

Explanation:

They would be dying off, or leaving to get away from the disease

6 0
3 years ago
Read 2 more answers
Rearrange the following list into the correct order to show the order of events in which the nervous system helps to initiate mo
pogonyaev

Answer:

1.message or impulse sent through the nervous system

2.body or lymph performes the action.

3.muscle contract

4.message received at muscle fibers

5.brain decides the action.

5 0
3 years ago
Other questions:
  • The __________ is the main control center for the autonomic nervous system. A. forebrain B. thalamus C. hypothalamus D. cerebrum
    9·2 answers
  • Which part of the brain controls balance posture and coordination?
    15·1 answer
  • The term for the volume of air inhaled and exhaled with each breath is
    5·1 answer
  • .) 12. According to cell theory, what do each of the following organisms have in common? A.They can all reproduce by spontaneous
    12·1 answer
  • Besides a veterinary surgeon, what other veterinary specialist is most directly involved in animal surgery?
    7·1 answer
  • What trait is recessive when you have a male rabbit with black fur and a female rabbit with tan fur
    10·1 answer
  • In science, an educated guess is a
    8·1 answer
  • How could genetic engineering be used to produce a more successful crop in a hot,
    12·2 answers
  • A cell that undergoes either mitosis or meiosis must first replicate it's DNA.
    7·2 answers
  • 6. What feature of a DNA fragment causes it to move through a gel during electrophoresis
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!