1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
otez555 [7]
2 years ago
13

What causes the

Biology
1 answer:
White raven [17]2 years ago
5 0

Answer:

B

Explanation:

B is the answer because the magnetic field of the earth attracts sun Ray's

You might be interested in
What component of the brain makes teenagers seek constant validation by sharing selfies with friends on social media?
attashe74 [19]

Answer:

Nucleus Accumbens

Explanation:Nucleus Accumbens - it is that part of the brain situated in the basal forebrain. it main function lie in reward and pleasure. it helps us to translate the willpower into actions. "it plays a major role in learning , laughter, aggression, etc. "

Nucleus accumben lies in each hemisphere of the brain.  it is divided into two main parts i.e. shell and core.

6 0
3 years ago
Where are amphibians who eat livingplants most likely to live in a lake
goldfiish [28.3K]

Answer:

the littoral zone

Explanation:

5 0
3 years ago
Jackie and Kim are each holding one end of a rope. Jackie moves her end quickly up and down. The rope moves up and down, as show
Eduardwww [97]

Answer: A wave

Explanation: Waves move in that kind of up and down motion, a circuit is a straight line with energy flowing through it, a magnet is a pulling effect and a prism is a shape, not necessarily a motion.

Hope this helps ^_^

6 0
3 years ago
In photosynthesis, light energy is (1 point)
shusha [124]

Answer:

D

Explanation:

glucose is produced a sugar water chemical

8 0
3 years ago
During the carbon cycle, animals and plants add carbon dioxide to the atmosphere through cellular respiration, and plants remove
sladkih [1.3K]

Answer: A

Explanation: subscribe to coryshyper

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement about water best illustrates the property of adhesion? water droplet found on a spider web in the morning water
    8·2 answers
  • Geneticists can create sequences of dna from rna using enzymes called
    10·1 answer
  • The time required for one complete cycle of binary fission is known as
    11·1 answer
  • 15 POINTS i will mark brainliest
    14·2 answers
  • Which of these is a cost of using fossil fuels?
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Fifty seeds were selected at random from each of 5 bags of seeds,and were kept under standardised conditions favourable to germi
    10·1 answer
  • How was the theory of the sun being made of coal determined to be false​
    12·1 answer
  • Human activites that affect water cycle​
    12·2 answers
  • 4. Analyze the roles of greenhouse effect<br>agriculture sector in Bhutan.<br>in the<br>-​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!