1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kati45 [8]
3 years ago
11

Which element has two energy levels magnesium or carbon?

Biology
1 answer:
ira [324]3 years ago
3 0
It’s magnesium magnesium has 3 levels and carbon only has two levels
You might be interested in
California enacts a statute to ban advertising in "bad taste." This stat-ute would likely be held by a court to be
emmainna [20.7K]

Answer:

Option A, an unconstitutional restriction of speech

Explanation:

Please see the attachment

7 0
3 years ago
Plant cells make their own food from the reaction between which two substances?
Kipish [7]
What are the two substances?
8 0
3 years ago
Read 2 more answers
as hominids evolved, their litter sizes decreased and their gestation period increased. which of the following inferences can be
yarga [219]
That the hominids evolved with an increase in development within the womb and became more of a quality over quantity species
5 0
3 years ago
What is the function of synaptic vesicles inside axon terminals? what is the function of synaptic vesicles inside axon terminals
Igoryamba

The correct answer is option (D) store and release neurotransmitters.

The function of synaptic vesicles inside the axon terminals is to store and release the neurotransmitters. A synapse refers to the junction between the two neurons which transmit the nerve impulses by the diffusion of a neurotransmitter. Synaptic vesicles ar important for the transmission or the conduction of the nerve impulses as they store and release the neurotransmitters.

These neurotransmitters are the chemicals that transmit an impulse between two neurons or a neuromuscular junction. A neurotransmitter is released by the synaptic vesicle of one neuron into a region between the two neurons called the synapatic cleft. From here, it reaches the neurtransmitter receptors present on the target neuron, thus conducting the impulse. Examples of neurotransmitters include the epinephrine, histamine, acetylcholine and others.

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • A common characteristic of schizophrenia and schizoaffective disorder is ______. question 26 options:
    13·1 answer
  • Prior to genetic engineering, humans often used _______ to gain desired traits in animals, such as dogs.
    5·1 answer
  • Which problem is most directly caused by burning waste?
    10·2 answers
  • Natural selection can lead to the formation of a new species which is called
    10·1 answer
  • Many cat species mark their territory by rubbing glands on their faces against a surface such as a tree trunk. This form of comm
    6·2 answers
  • Joyce is planting tulips in her garden, and she has 5 red bulbs and 5 white bulbs to plant in one row. What is the probability t
    7·1 answer
  • What are the causes of substance abuse?
    9·1 answer
  • If a man has blood type AB and the woman has blood type O, what blood type would you expect the children to have?
    7·1 answer
  • Explain the difference in How the tree and the fox get carbohydrates to use for energy
    15·1 answer
  • Which of the following is NOT an advantage of living on a floodplain?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!