1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wariber [46]
3 years ago
8

A client with the diagnosis of obsessive-compulsive disorder who has a need to wash his hands 50 to 60 times a day tearfully tel

ls the nurse, "i know that my hands aren't dirty, but i just can't stop washing them." what is the best response by the nurse?
Biology
1 answer:
alexgriva [62]3 years ago
8 0
I understand that—maybe we can work together to limit the number of times you wash them."
<span>R: The nurse shows an understanding of the client's needs by not totally restricting the handwashing and by working with the client to set limits on the behavior. At this time the client is still too anxious to be capable of coping with the reasons for handwashing. Continued handwashing does not reveal an understanding of the underlying problem, nor is it a sign of progress. Telling the client not to worry denies the client's feelings and may close off communication.</span>
You might be interested in
Not too sure about this question ↑ ​
Mashutka [201]

Answer:

the umbilical cord is connected to both the mother and the unborn child and so tranfers nutrients from the mothers blood to that of the baby's blood

7 0
4 years ago
Read 2 more answers
which of the following types of energy reception is most activated when a person is watching a silent movie
borishaifa [10]
<h3><u>Answer</u>;</h3>

Photoreception

<h3><u>Explanation</u>;</h3>
  • <em><u>Photoreception is a type of reception of light detection that lead to vision and depends on specialized light-sensitive cells called photoreceptors, which are located in the eye.</u></em>
  • Photoreceptors are the cells in the retina that respond to light. There are 2 types of photoreceptors in the retina namely; rods and cones. The rods photoreceptors detect light and are located in the retina. Cone are photoreceptors that are located in the retina and detect color.
7 0
3 years ago
1. Which of the following is the BEST description of forest soil?
wolverine [178]

Answer:

1. Thin Humus layer, minerals deep beneath the surface

2.Solar energy

Explanation:

I just took the test and got it right.

8 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Can someone help please?
sergij07 [2.7K]

uhm, though the graph doesn't match the problem, I remember doing this when I was in bio. If you are looking for the genome, it would be something along the lines of Gg, or GG (G=green dominant, g=yellow recessive)

I hope this is what you need!

4 0
3 years ago
Other questions:
  • Which statement describes the function of the plasma membrane?
    8·2 answers
  • I’m the Illustration, which site is an example of a trench
    15·2 answers
  • Which best compares Radiation and Conduction? Check all that apply.
    15·2 answers
  • A client with the diagnosis of obsessive-compulsive disorder who has a need to wash his hands 50 to 60 times a day tearfully tel
    8·1 answer
  • How do the muscles in the human body help with movement?
    11·2 answers
  • All living things need to transport molecules from one place to another in order to carry out necessary life functions.
    8·1 answer
  • Two identical wires are both carrying the same amount of current flowing in opposite directions.when these wires are brought clo
    14·2 answers
  • Which water depth had the biggest difference in survival rates for embryos with UV-B protection versus embryos without UV-B prot
    10·1 answer
  • Much of the oil and natural gas in the United States is located in
    15·1 answer
  • Which answer below accurately explains a scientific theory.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!