1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Temka [501]
3 years ago
13

Fish eat algae, organisms that makes their own food. Which types of organisms are present in the scenario?

Biology
2 answers:
Gala2k [10]3 years ago
5 0

Answer:

Herbivores and autotrophs

Anastaziya [24]3 years ago
5 0
Another answer would be heterotrophs (fish) and autotrophs (algae).
Heterotroph: consumer/ relies on other organisms for nutrients
Autotroph: producer/makes its own food
You might be interested in
Plz do 9❤️ No ones helping plz be nice
sveta [45]

Answer:

1.All living things are composed of cells.

2.Cells are the basic units of structure and functions in living things.

3.All cells are produced from other cells.

1. Theodore Schwann

2.  same scientist I believe

3. should be the same one

I hope this helps

6 0
2 years ago
What properties of iron bearing minerals on the seafloor support the theory of seafloor spreading?
BARSIC [14]
It would be the start up of iron. Causing it to be a reactant and spread it across.
7 0
3 years ago
A child who weighs 32 pounds receives a prescription for amoxicillin with clavulanate
Leni [432]

The child should not be given that prescription because 250 mg/125 mg amoxicillin and clavulanate potassium tablets should not be used until the child weighs at least 40 kg or 88.1849 pounds, because of the different amoxicillin to clavulanic acid ratios in the 250 mg/125 mg amoxicillin and clavulanate potassium tablets (250/125).

4 0
3 years ago
Human sperm cells and egg cells are
Alenkasestr [34]

Answer:

They make a zygote.

Explanation:

When they come together it is the first step into making a Baby.

8 0
3 years ago
Read 2 more answers
2. What procedure did you use to complete the lab? Outline the steps of the procedure in full sentences. Virtual Lab: Water Eros
Anettt [7]

The procedures that can be used to perform water erosion laboratory practicals are:

  • The use of detachment
  • Transportation
  • Deposition.

<h3>What is Water Erosion?</h3>

This refers to the biological process where rock particles are broken down into smaller particles and how they are removed by water.

Hence, we can see that in a laboratory experiment, one would need different apparatus such as:

  • Pitchers
  • Bottles
  • Soil
  • Water, etc.

This would be used to test the loss of water as it is put into the soil from the set of bottles to see how much the water is retained.

Read more about water erosion here:

brainly.com/question/1599677

#SPJ1

4 0
1 year ago
Other questions:
  • __is the five-carbon sugar found in DNA
    5·2 answers
  • Glucose is stored in ____ within the cell.
    10·2 answers
  • Behavior can be influenced by genetic traits. True False
    12·2 answers
  • AWNSER ASAP PLEASE!!!
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 16. Is the following sentence true or false? All distant galaxies are
    8·1 answer
  • Why is reducing caloric intake insufficient for a person to loose weight in a healthy way?
    10·1 answer
  • How do scientists determine where an earthquake starts?
    7·2 answers
  • HELPPP!!! What would the mass of an artificial cell containing 20mL of a 25% sugar solution be after it was placed in a beaker c
    5·1 answer
  • Kích thước, khối lượng của ARN và ADN
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!