Answer: A vertical organization structure is one that relies on managers to command and control their employees' work. A business owner is typically at the top of a vertical chain of command. There are advantages and disadvantages to a vertical structure.
Explanation:
Newton's first law which states that an object continues to be in its state of uniform or linear motion in a straight line unless an external force is applied on it.
Its for growth and to replace worn out cells
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
