1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
2 years ago
7

What is the best evidence to prove that irene was heterozygous for hemophilia? elizabeth is not a carrier for the trait. tatiana

carried the recessive allele. her brother has hemophilia and her sister is a carrier. two of her sons have hemophilia and one does not.
Biology
1 answer:
dezoksy [38]2 years ago
3 0

Hemophilia is an inherited bleeding disorder where clotting factors are either absent or present in low amounts. As a result, the blood doesn't clot. It is an X-linked recessive trait that is inherited.

<h3>What is X- linked recessive genetic illness?</h3>

Genetic abnormalities known as -X-linked recessive genetic illnesses are brought on by an atypical gene on the X chromosome. "Carriers" for a disease are females who have the disease gene on one of their X chromosomes. The fact that carrier females have a second copy of the gene to make up for the copy with the disease-causing alteration or mutation usually prevents them from showing symptoms of the ailment.

A male has one X chromosome, thus if he gets an X chromosome that carries a gene that causes a disease, the condition will manifest in him. Male X-linked If the other X chromosome from their mother is healthy, all of their daughters will carry the illness gene.

Learn more about hemophilia here:

brainly.com/question/1425282

#SPJ1

You might be interested in
How do autoinducers detect the population density
Iteru [2.4K]
They are signaling molecules that are produced in response to changes in cell population density. As the density of quorum increases so does the autoinducer
6 0
3 years ago
The _____ passively diffuses oxygen and carbon dioxide in and out of the cell.
polet [3.4K]
The _____ passively diffuses oxygen and carbon dioxide in and out of the cell.Through the plasma membrane, oxygen and carbon dioxide diffuses passively.
However, it is thru a transport that they in act to diffuse, -concentration gradient. 
3 0
3 years ago
How does a universal genetic code relate to the hypotheses about the origin of life on earth
Vikentia [17]
The referenced universal genetic code is understood to be DNA. Its multilevel coded intelligent design structure is a complex information system more complex than anything else in the universe and considerably more complex than anything humans have ever produced. The DNA structure is comprised of homochiral amino acids and pentose sugars that cannot be created through any naturalistic processes.

It is estimated that the the simplest organism is comprised of 600-1500 gene products, requiring >1 million nucleotides to properly decode and produce the proteins, RNA, enzymes and ribosomes that the cell is structured of.

Abiogenesis, the naturalistic hypothesis for the origin of life, has no explanation for the origin of life processes required to produce life. The intelligent designed DNA is proof of the existence of God, the creator of the universe and life. 
7 0
3 years ago
What minerals are found in bone? What do these minerals do for your bones
Sophie [7]
<span>Phosphorus. Phosphorus is another element that is essential for bone growth. 85% of our body's phosphorous is incorporated in our bones as calcium phosphate.</span>
4 0
3 years ago
Suppose that when you examined your tubes (in this exercise) after incubating them, you noticed that the unsealed control contai
aivan3 [116]
The Oxidation-Fermentation Test is used to differentiate bacteria built on their capability to oxidize or ferment specific sugars.
Once microbes are inoculated,-One tube is sealed with a layer of sterile mineral oil to promote anaerobic growth and fermentation.-The other tube is left unsealed to allow aerobic growth and oxidation.
Organisms able to ferment the carbohydrate or ferment and oxidize the carbohydrate will turn the sealed and unsealed yellow throughout.
Organisms able only to oxidize the sugar will turn the unsealed yellow medium and leave the sealed medium green or blue.
Fragile fermenters will convert both tubes slightly yellow at the top.
Organisms not able to metabolize the sugar will either produce no color change or will turn the medium blue due to alkaline products from amino acids degradation.
Since Pair #1 showed complete yellowing for sealed and unsealed, these Organisms able to ferment the carbohydrate or ferment and oxidize the carbohydrate. So our interpretation will be that the organism has: Oxidation and fermentation OR fermentation only.
For tubes #2 and #3, the sealed tubes were green throughout suggests that they need oxygen for aerobic growth, and the fact that their unsealed tubes showed light yellowing is evidence for oxidation. Sealed - Green and Unseal - Yellow. Our interpretation for these pairs of tubes would be : Oxidation
Tube 1 can be either Oxidation and fermentation OR fermentation only. So reliability of this needs to be confirmed more with additional testing.
Tubes 2 and 3 are most reliable because they can only be oxidation only and no fermentation.
6 0
3 years ago
Other questions:
  • What allowed the sumerians to pursue activities other than finding food?
    6·1 answer
  • Sperm in the lumen are unable to move independently and require ________ to move through the tubules of the testes.
    6·2 answers
  • Does a plant have a closed or open circulatory system
    8·1 answer
  • Which nutrient becomes depleted most rapidly during physical exercise?
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which describes how a compass works?
    15·2 answers
  • Six white-tailed deer and six sika deer were enclosed in a pasture for observation during an eight-year study in central Texas.
    5·2 answers
  • _____ can produce their own food. Autotrophs Heterotrophs Bacteria Protists
    8·2 answers
  • 13. A home telephone converts electrical energy only to sound energy, True or False?​
    12·1 answer
  • a typical human cell is approximately 12.00 μm in diameter and enclosed by a membrane that is 5.000 nm thick. what is the volume
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!