1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MatroZZZ [7]
2 years ago
6

Which of the following summarizes the Three-fifths Compromise?

Law
1 answer:
Margarita [4]2 years ago
6 0

A three-fifths compromise is the compromise that has been made by the slaves for the purpose of taxation and representation for a white person.

What is a three-fifths compromise?

A three-fifths compromise is a kind of agreement that has been made between the Northern and Southern state delegates at the U.S. Constitutional Convention (1787). It was mentioned in the agreement that direct taxation and representation in the House of Representatives would be done by the three-fifth slaves.

The compete question is attached in the image below.

Thus, three-fifths of the compromise was basically done by slaves for white people.

Learn more about the three-fifths compromise from here:

brainly.com/question/10987562

#SPJ1

You might be interested in
What led to Kepler's discovery of elliptical orbits? <br>Why was this significant for the time?​
djverab [1.8K]
Earth would move straight forward through the universe, but the Sun exerts a constant pull on our planet. This force bends Earth's path toward the Sun, pulling the planet into an elliptical (almost circular) orbit. His theories also made it possible to explain and predict the tides.
7 0
3 years ago
One way to avoid carbon monoxide poisoning is to:
KIM [24]

Answer:

open a rear window in your car

7 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Describe 2 ways in which the organisation supports the community<br>​
Paladinen [302]

Answer:

Organizations are important for your community because they focus each community's needs specifically. ... At the community meetings, members of the community as well as yourself, can voice opinions and concerns to help find solutions and push for new ideas and changes that can improve your neighborhood.

Not-for-profit organisations.

Companies limited by guarantee.

Charities.

Incorporated Aboriginal associations.

Incorporated associations.

Unincorporated associations.

Co-operatives.

https://www.tomcrimminsrealty.com/blog/the-importance-of-community-organizations.html

3 0
3 years ago
Read 2 more answers
Select the correct answer.
Natali5045456 [20]

Answer:

D, since he ensures security.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Members of the House of Representatives are elected by different states on the basis of their population at thoug members of the
    8·2 answers
  • I dont know what 2 plus 2 is
    8·2 answers
  • 3 points
    7·1 answer
  • The vertex form of the equation of a parabola is y = (x-4)2 + 22.
    7·1 answer
  • Feels like we're on the edge right now
    12·2 answers
  • Want fifty points? Well here u go. LOL
    11·1 answer
  • Using the event of the Columbine Shootings of 1997: You must state what actions the local government, state government, and fede
    8·1 answer
  • Please help me it’s due today:)
    12·1 answer
  • Elena has been hired by the mayor of a busy city to evaluate the latest crime statistics. He tells Elena that the city has seen
    6·2 answers
  • 8. What qualifies as a projected bloodstain?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!