1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dovator [93]
3 years ago
15

State what is a demand schedule on create a demand schedule​

Law
1 answer:
pochemuha3 years ago
7 0

Answer:

In economics, a demand schedule is a table that shows the quantity demanded of a good or service at different price levels. A demand schedule can be graphed as a continuous demand curve on a chart where the Y-axis represents price and the X-axis represents quantity.

Explanation:

You might be interested in
Which speaker of which statement would be best served by joining an interest group? Help ASAP
gayaneshka [121]

Answer:

D. "I strongly support Republican candidates for public office"

Explanation:

8 0
3 years ago
Read 2 more answers
The law of which country provided the roots for U.S. law?
Hoochie [10]

Answer:

Background. At both the federal and state levels, the law of the United States was mainly derived from the common law system of English law, which was in force at the time of the Revolutionary War. However, U.S. law has diverged greatly from its English ancestor both in terms of substance and procedure.

5 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Donald, a mechanic at an auto shop, accidentally spilled some gasoline in the parking lot of the auto shop and failed to clean i
boyakko [2]

Answer:

yes he can because he failed to clean up the gas and if he failed to clean it that means he did not clean it or he cleaned it but not the right way

so if had not cleaned it then yes he can

if he did clean it but not the right way he still can because he most likely new that it was not clean all the way because with out a doubt gas spelled on his side through out his owner ship of the auto shop so he should all ready know how to clean up gas so if he did not clean it up right he would know that, and since his carelessness led to that fire he can be heled liable

hope i helped

Explanation:

6 0
3 years ago
Question: Did the President and Congress go beyond their war powers by implementing exclusion and
Tom [10]

Answer:

Yes the government did

Explanation:

just because they have a Japanese descent doesn't mean they are also bad, for example, i can't say all boys are bad because one of them was mean

5 0
3 years ago
Other questions:
  • When is self-defense plea most commonly used?
    11·2 answers
  • Which of the following is true of the Federal Trade Commission?
    13·1 answer
  • PLEASE HELP!!!!!!! (Will Mark Brainliest!)
    8·1 answer
  • Why is the supremacy clause considered to be the root of federalism?
    14·2 answers
  • Beth is a victim of Carl’s violation of a criminal law. Criminal law is concerned with
    13·2 answers
  • What does it take you to be a police officer or state trooper
    15·1 answer
  • PLEASE ANSWER QUICKLY
    12·1 answer
  • If you were a juror in a murder case, and the DNA, blood, fingerprints, or other scientific evidence conflicted with what witnes
    14·1 answer
  • Name 2 SUSPECT factors that affect the validity of eyewitness testimony.
    14·1 answer
  • "Vulnerable road user” is a term used to identify those road users who ...
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!