1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
14

The ___________ gland sits in the neck region and releases hormones that control the rate of metabolism

Biology
1 answer:
Setler [38]3 years ago
7 0
<span>Thyroid and Parathyroid Glands. The thyroid is a dual lobed gland located in the neck region. It secretes hormones that control metabolism, growth, heart rate, body temperature, and regulate calcium levels. Hormones secreted by the thyroid include thyroxin, diiodothyronine, and calcitonin.</span>
You might be interested in
Corn rust is a pathogen caused by fungus that can attack corn plants and cause wide spread damage to this staple crop. Much of t
AlekseyPX

Answer:

D

Explanation:

6 0
3 years ago
Read 2 more answers
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
The administration method that takes the longest time for the drug to reach the brain is __________.
photoshop1234 [79]

Oral ingestion or swallowing is the administration method that takes the longest time for the drug to reach the brain. When using this method, the drug is swallowed through the mouth, moves to the stomach and then into the bloodstream before it can be transported to the brain. This means that it takes longer for a swallowed drug to start functioning than it does with other methods of administration such as injecting.






4 0
3 years ago
In preparation for mitosis, dna is copied; this is called dna
Anastaziya [24]
DNA replication if i am correct

7 0
3 years ago
In what way do two alleles for the same trait differ?
kvasek [131]
I think it’s C explanation : i learned this a while ago
8 0
3 years ago
Other questions:
  • "what is the smallest n for which the belief in the disease"
    14·1 answer
  • PLEASE HELPP MEEE I beg youu
    11·1 answer
  • Total arable land area 14,844 square mile number of farms 47,600
    13·1 answer
  • Which of the colors absorbed by chlorophyll is least visible?
    8·1 answer
  • What is the collective name for the animals found in australia who carry their young in pouches?
    9·1 answer
  • One of the main drawbacks to extinction is that:
    11·1 answer
  • Match the natural resource to the segment of history on which it had a large impact.
    6·1 answer
  • Prisms produce the colors of the rainbow through?
    15·1 answer
  • Question 8
    8·1 answer
  • Why a cell spends the majority of its time in interphase.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!