1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
2 years ago
10

The process of combining two incomplete proteins to make a compete protein is called?

Biology
1 answer:
Allushta [10]2 years ago
8 0

Answer:

Mutual supplementation

Explanation:

You might be interested in
What substance is considered a building block for all living things?
kondaur [170]
~Hello there!

Your question: What substance is considered a building block for all living things?

Your answer: Carbon is the substance that is considered s building block for all living things.

Any questions ^?

Happy Studying!
3 0
4 years ago
Read 2 more answers
Which cell structure serves the stated function in both eukaryotic and prokaryotic cells?
tamaranim1 [39]

Answer:

Cytoplasm

Explanation:

Eukaryotic cell: cell membrane, cytoplasm and nucleus

Prokaryotic: cytoplasm, has no nucleus

7 0
4 years ago
Read 2 more answers
A particular bird species found in North America obtains most of its food energy by catching and eating insects. A mutation aris
patriot [66]
The answer is D. Individual birds with the mutation will be more likely to survive than birds without the mutation
5 0
3 years ago
Read 2 more answers
Pls help me answer thank you
saveliy_v [14]

Answer:

b is the correct answer

Explanation:

hope it helps u..

7 0
3 years ago
What is ultimate purpose of digestion
Mars2501 [29]

Explanation:

Digestion is important for breaking down food into nutrients, which the body uses for energy, growth, and cell repair. Food and drink must be changed into smaller molecules of nutrients before the blood absorbs them and carries them to cells throughout the body.

4 0
3 years ago
Other questions:
  • How are the frog nostrils different from human nostrils
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Write a paragraph describing how water changes state.
    8·1 answer
  • A Group of students performing an experiment collect Euglena samples from a pond and keep them in darkness in a vessel containin
    13·2 answers
  • 6. Ribosomes contain a mixture of ribosomal RNA (rRNA) and ribosomal proteins. In most cases, any particular rRNA or ribosomal p
    7·1 answer
  • The side of photosynthesis
    14·1 answer
  • What do the phase changes (condensation, evaporation, crystallization) in the water cycle have in common?
    10·1 answer
  • Explain how important is the role of the parents during the earlier stage of development?​
    11·1 answer
  • Two functions of the anther and why it attracts insects.​
    5·1 answer
  • Bioaugmentation involves Group of answer choices adding nitrogen and phosphorus to an area in need of remediation. adding specia
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!