1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leviafan [203]
2 years ago
5

Imagine you are designing a movie or video game monster based off of the tongue-eating isopod. Describe how you would translate

this real-world creature into a fictional monster. You can use elements of the other parasites discussed in the article and chapter.
Biology
1 answer:
algol [13]2 years ago
3 0

The processes involved in game design are:

  • pre-production,
  • production,
  • post-production.

<h3>What is a Game Design?</h3>

This refers to the use of design to create video games from start to end to be appealing to gamers.

Hence, we can see that your question is incomplete so I gave you a general overview to help you get a better understanding of how games are designed.

Read more about game design here:

brainly.com/question/26066869

#SPJ1

You might be interested in
What would happen to the other organisms if the killer whales migrate to other water to hunt and fail to return ?
Margarita [4]
They most likely died
4 0
3 years ago
Which isotope has a relatively short half-life?
beks73 [17]
Oxygen-16 and Carbon-12 are stableisotopes of elements O and C respectively. Hence, they do not have half-lives. But Carbon-14 andUranium-238 are radioactive isotopes. Among them Carbon-14 has relatively short half-life as about 5730 years while Uranium-238 has a long half-life as about 4.5 billion years.

Answer is. uranium-238
3 0
4 years ago
1.6 (IB 2017/MAY – SL P1/5C) When during the cell cycle does DNA replication take place?
Evgesh-ka [11]

Answer:

Mitosis!!!!!!!!!!!!!!

7 0
4 years ago
A solution that contains equal numbers of hydrogen and hydroxyl ions would be called
alukav5142 [94]
Acidic basic alkaline neutral
6 0
4 years ago
Which of the following does NOT accurately state a transfer of carbon in the carbon cycle?
Doss [256]

Answer:

The point that does NOT accurately indicate a carbon transfer in the carbon cycle is that burning of wood and debris pulls carbon from the atmosphere to use as energy.

Explanation:

The carbon cycle involves the journey that carbon makes between living organisms and their surrounding environment, i.e. the entire biosphere, geosphere, hydrosphere and atmosphere, and is therefore considered a biogeochemical cycle.

In living organisms, inorganic carbon is taken up by plants to make organic molecules, which will be used by animals - which release CO₂ into the atmosphere - or dead organic matter provides carbon to the soil.

The combustion of wood and debris involves the oxidation of a combustible material -which requires oxygen from atmosphere- to then release CO₂ as a product. So it is incorrect to say that burning of wood and debris pulls carbon from the atmosphere to use as energy.

6 0
4 years ago
Other questions:
  • The plants take carbon dioxide and water in the presence of sunlight to make oxygen and carbohydrate. This process is called ___
    7·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Imagine that plaque uniformly coats the walls of the blood vessel in the diagram. Based on the diagram, what is the reduced area
    7·1 answer
  • As a result of long term aerobic training the body tends to depend more on __________ as a substrate for metabolism
    9·2 answers
  • Which of the following is an extinct group of mollusks related to today's chambered nautilus?
    14·2 answers
  • The island of Surtsey was formed by volcanic eruption and first appeared in 1963. Figure 1 contains descriptions of changes in t
    5·2 answers
  • What is the purpose of mitosis for our bodies?
    13·1 answer
  • Where does the process of transcription begin?
    6·1 answer
  • HELPPPPPPPPPP PLSS BRAINLIEST REAWARD!!!!!!!!!!!
    11·1 answer
  • Part E
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!