What force has the most influence on the depth of tides?

1 answer:

6 0

Tides are the rise and fall of sea levels caused by the combined effects of the gravitational force sexerted by the Moon and the Sun and the rotation of the Earth. The times and amplitude of tides at a locale are influenced by the alignment ..... South of Cape Hatteras the tidal forces are morecomplex, and cannot be predicted ...

You might be interested in

Each of the four pedigrees that follow represents a human family within which a genetic disease is segregating. Affected individ

Ne4ueva [31]

Answer:

The following four traits are -:

Pedigree 1 - A recessive trait (autosomal recessive) is expressed by pedigree 1.
Pedigree 2- Recessive inheritance is defined by Pedigree 2.
Pedigree 3 - The inheritance of the dominant trait (autosomal dominant) is illustrated by Pedigree 3.
Pedigree 4- An X-like dominant trait is expressed by Pedigree 4.

Explanation:

Explaination of each pedigree chart-

Pedigree 1 demonstrates the recessive trait since their children have been affected by two unaffected individuals. If the characteristics were X-linked, in order to have an affected daughter, I-1 would have to be affected. $X^A$ In this, both parents are autosomal recessive trait carriers, so the child will be affected by a 1/4 (aa)
Recessive inheritance is defined by Pedigree 2. This is X-related inheritance as autosomal recessive inheritance has already been accounted for in part 1. This inference is confirmed by evidence showing that the father (I-1) is unaffected and that only the sons exhibit the characteristic in generation II, suggesting that the mother must be the carrier. The individual I-2 is a carrier for this X-linked trait. A typical Xa chromosome is attached to the unaffected father (I-1), so the chance of carrier II-5 is 1/2. Probability of an affected son = 1/2 (probability II-5 is a carrier) x 1/2 (probability II -5 contributes ( $X^A$ ) x 1/2 (probability of Y from father II-6) = 1/8. An affected daughter's likelihood is 0 because a typical $X^A$ must be contributed by II-6.
The inheritance of the dominant trait is demonstrated by Pedigree 3 because affected children still have affected parents (remember that all four diseases are rare). The trait must be autosomal dominant because it is passed down to the son by the affected father. There is a 1/2 risk that the heterozygous mother (II-5) would pass on mutant alleles to a child of either sex for an autosomal dominant feature.
Pedigree 4 is an X-linked dominant function characterized by the transmission to all of his daughters from the affected father but none of his son. On the mutant X chromosome, the father (I-1) passes on to all his daughters and none of his sons. As seen by his normal phenotype, II-6 therefore does not bear the mutation. An affected child's likelihood is 0.

In the question the pedigree chart was missing ,hence it is given below.

7 0

3 years ago

Can someone please help me?

oee [108]

Hitherei thinkthe answeris1

4 0

2 years ago

Read 2 more answers

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0

2 years ago

the most likely cause of sinkholes in areas like Florida and Kentucky is (A) the water table being so close to the Earth's surfa

enyata [817]

C is the answer c c c c c c c c c c c c c c c c c x c c x x x x x x x x x x x x x d c

4 0

3 years ago

If someone could dig a safe tunnel through the earth how long would it take to free fall to the center?

Reptile [31]

Answer: A scenario often presented to introductory physics classes is that of a "gravity tunnel" — a tube drilled from one side of the Earth to the other through the planet's center. The answer taught for nearly a half-century for how long a fall through such a hole would take was about 42 minutes and 12 seconds.

Explanation: However, solar and lunar gravity, which also perturb orbiting satellites, would eventually pull you into the tunnel wall anyway [source: Darling ]. Strike a chord: Fun fact: A straight line from any point to any other point through the planet would take the same amount of time to fall through like a tunnel through Earth's center.

6 0

1 year ago