The heat causes them to open up and flow air
Why is it important to protect ecosystems? What could happen to the biotic and abiotic factors if we don’t take care of them?
It protects the resources and organisms that depend on one another in the ecosystem
What would be the impact on the organism and the biomes?
A rise in temperature in the tundra for the polar bears:
They would get overheated since they are prepared for the colder temps with their fur-also causes the ice to melt and alter its food supply
A decrease in rainfall for the flowers in the rainforest:
They would likely die due to a lack of water
A decrease in temperature for jackrabbit in the desert:
They would get very cold since they are used to the extreme heat
An increase in temperature for the black bear in the temperate deciduous:
They would get very hot and be trouble due to their fur and dark coloring
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
The endocrine system
Explanation:
Endocrine basically means "having to do with galnds that produce hormones and release them into the bloodstream."
