Water, ice, and wind can all cause weathering. Climate can also affect the rate of weathering.
All cells come from pre-existing cells
C. Food Processor
Explanation - Food processor is an appliance used in the kitchen that performs multiple purposes like blending, chopping, slicing etc. It makes the preparation of food very easy. Depending on the blades attached to the processor, the working of it varies.
It is also very convenient to use and does not require liquid for doing its purpose like electric blender. It is an electricity based device. It works only when the lid is properly closed to ensure there is no spillage of food and the device is safe to use.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.