Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
east to west
Explanation:
The stars and moon are the celestial bodies which are located at distant.
The distance of stars vary but moon and sun remain same. As our Earth rotates at its own axis, other celestial bdies seem to move.
As Earth spins from west to east, the stars and moon seems to move from east to west direction at night and same with Sun, it also seem to move from east to west.
Hence, the correct option is east to west.
Answer:
A. Urethra
Explanation:
The part highlighted below is also known as the Urethra, or the tube in which the urine or semen travels in the male reproductive system! :)
Bro I think it's A
Gravitational pull comes from the core. How rotated u are won't matter, but how far u are from the core will matter.
by the law of natural selection, daddy charles darwin stated that overpopulation could result in famine and wars, and death would accelerates across nations, so overpopulation is a cause for this because of too many organisms but not enough food, which declined growth rate.
