1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Deffense [45]
3 years ago
8

Plzz help me

Biology
1 answer:
7nadin3 [17]3 years ago
6 0
The one or two letter symbol is the element’s symbol and usually included the name underneath. the atomic number it on the top left and is the number of protons. the numbers at the bottom is the atomic mass. This tells us how the element is set up and it’s grouping with other elements similar to it.
You might be interested in
Do prokaryotic cells have nucleic acid?
elena-s [515]

Answer:yes

Explanation:

6 0
3 years ago
The ________ duct empties into the vestibule at the level of the second upper molar.
gavmur [86]

The parotid duct empties into the vestibule at the level of the second upper molar.

Around the back of your lower jaw is where the parotid gland is located. Saliva then passes via a tube known as the parotid duct. The duct's opening is where the saliva spills into your mouth. Different factors might cause the parotid duct to become clogged. The region may swell up as a result of this.

Each gland's front faces a lengthy excretory channel called the parotid duct, which emerges just beneath the masseter muscle. The duct enters the mouth by the buccinator muscle and opens on the inner cheek surface, typically next to the maxillary second tooth

To learn more about Parotid duct please visit -brainly.com/question/14327466
#SPJ4

4 0
2 years ago
Warm-Up:
Agata [3.3K]

Answer: Warm-Up:

Write down two places in the school where

you think there might be a lot of bacteria,

and write down two places in the school

where you think there will be very little

bacteria. Explain why you chose these

places.

Explanation:

There is a lot of bacteria in the restroom because it is they restroom of course and there is a lot of people who go in and out through out the day. Some people do not wash their hands after using the bathroom, also from other places. One of the most cleanest areas might be the science lab because they are always cleaning up everything and disinfecting.

8 0
3 years ago
Read 2 more answers
Which of the following could be considered
Lemur [1.5K]

Answer:

considered what? the question was not finished

Explanation:

5 0
3 years ago
Read 2 more answers
In which population is genetic equilibrium most likely to occur?
bazaltina [42]

Answer:

RANDOM MATING

Explanation:

random mating

The Hardy Weinberg principle of genetic equilibrium defines that gene and allelic frequencies will remain the same among the generations in an infinitely large interbreeding population. In this population the mating among the members of the population is random and no selection, migration and mutation will occur.

8 0
3 years ago
Other questions:
  • Which of the following best describes the solar radiation absorbed by and radiated from earth?
    7·1 answer
  • A white mouse crossed with a black mouse all the offspring were grey the genes for fur color in mice show
    12·1 answer
  • Popular diets emphasizing low-carbohydrate intake are controversial partly because __________.
    14·1 answer
  • How do blue whales catch their prey?
    10·1 answer
  • What are sunspots? Pls help
    11·1 answer
  • A distinct biological characteristic that can be passed from one generation to the next is commonly known as a
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A biological reserve that is designed for a single species is an important tool in maintaining biodiversity because a reserve:__
    12·1 answer
  • Which describes bedrock?
    5·2 answers
  • We know that the pressure of water increases with depth. Then, which of the following shows the most possible shape of a dam?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!