1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fantom [35]
2 years ago
12

Select the correct answer from each drop-down menu. what are the four types of nitrogen bases of dna nucleotides? the four types

of nitrogen bases of dna nucleotides are , , guanine, and cytosine.
Biology
1 answer:
Hitman42 [59]2 years ago
7 0

The four types of nitrogen bases of dna nucleotides are:

  1. Adenine (A)
  2. Cytosine (C)
  3. Ganine (G)
  4. Thymine (T).

These bases form specific pairs (A with T, and G with C).

<h3>What is DNA nucleotides?</h3>

Nucleotides can be defined as those organic substances consisting of a nucleoside and a phosphate.

They serve as monomeric units of the nucleic acid polymers –

  • Deoxyribonucleic acid
  • Ribonucleic acid,

So therefore, the four types of nitrogen bases of dna nucleotides are:

  • Adenine (A)
  • Cytosine (C)
  • Ganine (G)
  • Thymine (T).

Learn more about DNA nucleotides:

brainly.com/question/16273896

#SPJ1

You might be interested in
Which is not a topic of biology?
Sonbull [250]

Answer:

the speed at which hummingbirds fly because that is actually a part of physics

6 0
3 years ago
Read 2 more answers
How does a good experimental conclusion differ from an inference
Lady_Fox [76]
A conclusion is a final answer backed by evidence. An inference is a reasonable guess.
6 0
3 years ago
Nearly all eukaryotic cells contain a class of small, round organelles that contain oxidative enzymes. The enzymes break down or
Ivenika [448]

The correct answer is peroxisomes.  

Peroxisome refers to a small organelle found in the cytoplasm of various cells that comprises catalase (the reducing enzyme) and generally some oxidases.  

They are the minute vesicles and comprises the digestive enzymes used for dissociating toxic components in the cell. They are not similar to lysosomes on the basis of the kind of enzymes they withheld. The peroxisomes generally contain enzymes that need oxygen, that is, oxidative enzymes.  


4 0
3 years ago
A food chain is represented below.
soldi70 [24.7K]
The answer is 4 chemical energy from the grass.
HAPPY NEW YEAR!
5 0
3 years ago
Read 2 more answers
Predict what will happen to a fish if its gills are torn after being caught in a net.<br>​
viva [34]

Answer:

It will die.

Explanation:

Fish need functional gills to live.

7 0
2 years ago
Other questions:
  • Why would decaying logs in the woods not be an abiotic factor?
    15·1 answer
  • Describe the importance of biomes such as forests, freshwater, and marine biomes? How have human actions affected these biomes?
    7·1 answer
  • 95 points URGENT WILL GIVE BRAINLIEST PLEASE HELP FAST
    5·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Your hypothesis should be based on_____________?
    14·1 answer
  • During which stage of meiosis do homologous chromosomes form tetrads?
    7·1 answer
  • Which of the following types of pollution is not linked to coal-burning power plant emissions?
    15·1 answer
  • How do you write 215500 in scientific
    11·1 answer
  • 15.) Mutated<br> will make mutated<br> ! which will make the wrong
    14·1 answer
  • As bile is produced and secreted, what structures or cells does it encounter?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!