1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
2 years ago
10

What impact does nitrogen depletion have on the ecosystem?

Biology
1 answer:
daser333 [38]2 years ago
5 0

Due to nitrogen depletion  is developed, causing leaves to turn yellow in plants. Thus, option A is correct.

<h3>What is the effect of depletion of nitrogen on ecosystem?</h3>

Nitrogen plays a very vital role in our ecosystem such that due to presence of nitrogen plants grow rapidly, produce bigger size fruits & flowers.

chlorosis

Hence due to depletion of nitrogen plants are getting yellowed it means it produces smaller fruit.

In modern era farmers add nitrogen containing fertilizers which produce large amount of grains, foods and fruits which is also diseases free.

Therefore due to nitrogen depletion chlorosis is developed, causing leaves to turn yellow in plants. Thus, option A is correct.

Learn more about depletion of nitrogen here:

brainly.com/question/16546637

#SPJ1

You might be interested in
Hello! Happy New Years! If someone could help me with this problem real quick, I would greatly appreciate it! Thanks in advance!
Vladimir [108]

Answer:

increase in water vapor and decrease in energy leaving the planet and increase in temperatures.

Explanation:

This is just what I think I might be wrong though.

5 0
2 years ago
Which process is performed by both plants and animals to break down sugar to provide energy in the form of ATP
tamaranim1 [39]

The process living creatures go through to break down sugars and turn them into ATP is called Cellular Respiration.

7 0
3 years ago
The process by which energy is derived from solar radiation that is used by certain organisms to form organic matter is called:
JulsSmile [24]
<span>Photosynthesis. Photosynthesis is a process whereby green plants and other organism like bacteria produce their food using organs like chlorophyll in plants and plasma membrane in bacteria to convert solar energy into chemical energy. The energy is stored in carbohydrate molecules, such as sugars, which are synthesized from carbon dioxide and water. Most plants, algae, and cyanobacteria perform photosynthesis. These organisms and plants produce organic waste product like water and Oxygen which is essentially for life on earth.</span>
5 0
4 years ago
Draw the structure of ATP molecule and explain how it is formed​
monitta

I hope it will help you...

7 0
3 years ago
Read 2 more answers
Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′
Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0
4 years ago
Other questions:
  • If the dissolved salt concentration outside the cell is higher than inside the cell, what process will move water out of the cel
    12·1 answer
  • Explain how the structure of the cell membrane is related to its function.
    6·2 answers
  • Explain why it is important to create experiments that are reproducable by other people.
    10·2 answers
  • Need answer quick!!!!!! 20 Points!!!!!! Will give Branliest !!!!!!1
    10·2 answers
  • If you wanted to persuade someone that tiger poaching is wrong, do you think written,spoken or visual message might be most effe
    15·1 answer
  • What organisms will you find in deeper cooler water?
    15·1 answer
  • Define the process of the above diagram​
    11·1 answer
  • At the end of meiosis I, chromosomes in the two resultant cells are duplicated but not homologous true or false
    13·1 answer
  • After you decide what information to collect in a descriptive investigation, you need to _____.
    15·2 answers
  • Earning Task 1 rections: Observe a landscape garden in your nearby area. In three to five sentences, give your ideas based on yo
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!