1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kap26 [50]
2 years ago
10

Anyone have the answers?

Law
1 answer:
tiny-mole [99]2 years ago
6 0

Yes with advances in technology, there may come a time that the use of mugshots as well as fingerprints may become obsolete.

<h3>What are the uses of the mugshots and the fingerprints</h3>

These are the ways that criminals can be identified when they have committed a crime. The issue with the fingerprint technology is that it is not always secure while the the mugshot only works when the person has been caught directly for the offence they committed.

The use of the live scan machine can what can be used in order to ensure that the mugshot and the fingerprinting process is faster.

Fingerprints scanning is known to be the oldest and the fastest ways of identifying people hence its adoption in the need for solving crimes and forensic examinations. This is because it is said that no two people have the same fingerprints. Even though they may be identical twins.

Read more on fingerprints here: brainly.com/question/2114460

#SPJ1

You might be interested in
Common Law
Anika [276]
The answer to your question is (D)
8 0
3 years ago
Carlos pays a restaurant that already has an operational format, logo, and recipes to use their models and materials to open his
Dovator [93]
D is the answer. Carlos is paying and has a operational format, logo, and recipes.
8 0
3 years ago
C. political leaders
bixtya [17]

Answer:

4. C 5. D 6. D. 7. B

Explanation:

Check if I am right before confirming your answers.

4 0
3 years ago
Discuss in at least one paragraph how creating and maintaining healthy habits impacts your studies.
matrenka [14]

Answer:

Maintaining healthy habits impacts your studies by making you better at time management to get things done quicker and easier. But bad habits decrease this, so healty habits must be maintained to improve your studies for the better. when you create healthy habits it makes everything especially studying easier to accomplish. Healthy habits like making a schedule to manage time is a good habit because it keeps you on track when your busy. if you don’t continue your studies you could fail at what you are doing and healthy habits impact this extremly. So healthy habits help studies for the better and are incouraged.

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Explain each of the three branches of government. What are their duties and responsibilities?
    7·1 answer
  • WILL MAKR BRAINLIEST
    9·2 answers
  • The highest authority in the United States is the
    8·2 answers
  • how much proof is necessary for a criminal trial? how is this different from the amount of proof necessary in a civil trial?​
    5·2 answers
  • What are the 3 appendices?
    10·1 answer
  • How do i do this?
    11·1 answer
  • If you have an idea for a new law, what can you do to get the government to consider passing it? Choose the best answer.
    11·1 answer
  • Your organization is an organic food supplier with employees in the following jurisdictions:
    10·1 answer
  • Members of the u. S. Supreme court serve for how long?.
    13·1 answer
  • Name 3 ways that people are ushered into a permanent 2nd-class status via the criminal justice system.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!