1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
7

Mikah is creating a poster for her science class to illustrate the major factors responsible for reducing the amount of global b

iodiversity on the Earth. Which of the following should most likely be included on her poster?
A)the conservation of natural ecosystems
B)the destruction of plant and animal habitats by humans
C)the observation of wild organisms by scientists
Biology
2 answers:
Vladimir [108]3 years ago
7 0

Answer:

Answer choice B

tangare [24]3 years ago
5 0

Answer: B) the destruction of plant and animal habitats by humans

Explanation:

The global biodiversity is reducing due to natural and human induced environmental changes such as volcanic eruption, landslides, earthquakes and human induced forest fires, nuclear explosions and others. Apart from the changes in the environment. The human beings are directly responsible for the reduction in the area occupied by the biodiversity of plants and animals for maintaining the urban infrastructure.

On the basis of the above explanation, this can be said that B) the destruction of plant and animal habitats by humans is the relevant option that should be included in the poster.

You might be interested in
5. What type of energy is needed for active transport?
Leya [2.2K]
ATP( adenosine triphosphate )
6 0
3 years ago
Read 2 more answers
In what zone is the ability to burrow and sustain changes in temperature and salinity important for an organisms' survival?
den301095 [7]
The correct option is C.
Living organisms that live in the littoral zones in the ocean are used to frequent changes in temperature and in the salinity of the ocean water. For an organism to survive in this environment, it needs to have adaptive features that will increase its survival. The littoral zone is divided into three zones, which are high, middle and lower littoral zones. Organisms living in high littoral zone have adaptive features that make them more adapted to desiccation due to the long hours of sunlight to which they are exposed. The organisms are usually exposed directly to the air or they can be enclosed in burrows.
3 0
3 years ago
Read 2 more answers
Is a disease like Ebola considered an epidemic or a pandemic? Explain why in your words pls
Black_prince [1.1K]
An empidemic because it kills more people than we can count
5 0
3 years ago
Read 2 more answers
The effects of anaerobic conditions how would anaerobic conditions (when no o2 is present) affect the rate of electron transport
Romashka-Z-Leto [24]
Anaerobic condition refers to an environmental condition where oxygen is absent. In case of Electron Transport System (ETS) and ATP production, oxygen acts as the final acceptor of electrons. As oxygen is a reactant in ETS and ATP production, unavailability of oxygen can cause no oxidation of the coenzymes or the carriers such as NAPH and FADH2 and no ATP will be produced. Thus, both Electron Transport System and ATP production will stop in the absence of oxygen.
6 0
3 years ago
What contains instructions to cells about how to form a heart ?
madam [21]
The deoxyribonucleic acid (DNA)
6 0
3 years ago
Read 2 more answers
Other questions:
  • Where in plant cells are the energy-absorbing molecules for photosynthesis located? Select one: a. thylakoids b. mitochondria c.
    13·1 answer
  • Twenty-five-year-old Jonah is wondering whether his rate of sperm cell production is within normal range. For a man his age, his
    10·2 answers
  • The crystal of a mineral are always the same size. True or false
    10·2 answers
  • What percent of the trees cut down are used for something other than paper?
    9·2 answers
  • Pls help me for brainliest
    10·2 answers
  • Henrietta is in the fifth week of her pregnancy, which means that she is in the _____ period of prenatal development.
    10·1 answer
  • How do the characteristics<br> of viruses and bacteria<br> compare?
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Each type of cell in a multicellular organism has a specific job that is important to the what
    14·1 answer
  • What can occur nitrogenous bases do not pair correctly?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!