1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
2 years ago
7

Features that result from wave deposition include

Biology
1 answer:
Fynjy0 [20]2 years ago
8 0

Answer:

b.barrier islands

Explanation:

You might be interested in
What age do you start puberty.
Paul [167]
Maybe when your moms age when she started or maybe it just start
4 0
3 years ago
Read 2 more answers
The female portion of the flower is the
Reil [10]
The answer to your question is A carpel
6 0
3 years ago
The mammals whose offspring are little more than embryos are? A. Monotremes B. Marsupials C. Placentals
saveliy_v [14]
The answer is "B. Marsupials". Marsupials undergo relatively premature births compared to many other species, and although this puts the baby at risk, it lessens the risks for the mother.
6 0
3 years ago
Read 2 more answers
What is a difference between a waxing crescent and a waning gibbous
slega [8]

Answer:

But what does “waxing and waning gibbous” mean? Rob says crescent is when you can see less than half of the moon illuminated. “Gibbous, you attach that to either waxing or waning when you see more than half of the moon illuminated,” he said. Waxing means it's getting bigger while waning means it's getting smaller.

3 0
3 years ago
Read 2 more answers
In photosynthesis what substances are produced
NikAS [45]
Carbon dioxide and water are converted into glucose and oxygen
8 0
4 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • residents of a town are concerned that a recently built factory could pose health risks. Scientists were asked to investigate th
    10·1 answer
  • What distinguishes the savanna and grassland biomes?
    15·1 answer
  • Does anyone kowns the answer to theses questions? any help will do
    15·1 answer
  • The word “cumulative” means that something builds on itself. Which example best shows how scientific knowledge is cumulative?
    8·1 answer
  • Based on the fossil, which organism evolved first
    6·1 answer
  • What is the relationship between "seeing" with the eye and "perciving" with the brain
    13·1 answer
  • Do capillaries transport blood from arteries to veins?
    14·1 answer
  • Hi i was wondering what a strong CER would be for the following scientific question:
    15·1 answer
  • What would happen to the life of a cell if there was no Golgi apparatus?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!