1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
1 year ago
8

jansman, a. j., verstegen, m. w., huisman, j., and van den berg, j. w. 1995. effects of hulls of faba beans (vicia faba l.) with

a low or high content of condensed tannins on the apparent ileal and fecal digestibility of nutrients and the excretion of endogenous protein in ileal digesta and feces of pigs. j. anim. sci. 73:118–127.
Biology
1 answer:
gayaneshka [121]1 year ago
8 0

The effects of dietary inclusion of faba bean hulls (Vicia faba L.) with a low (.1% catechin equivalents; LT) or high tannin content  on the obvious ileal and faeces digestibility of nutrients were studied in three experiments (Exp. 1, 2, and 3) with young pigs (BW 10 to 26 kg).

<h3>Faba beans</h3>

Additionally, using the 15N isotope dilution method, the actual digestibility of the meals' protein and the excretion of endogenous protein (N x 6.25) in the ileal digesta and feces of pigs were assessed.

Diets either contained casein and faba bean cotyledons as highly soluble (HS) protein sources (Exp. 1 to 3) or protein sources with a low solubility (LS), such as potato protein, soy concentrate, sunflower meal, animal meal, and fish meal.

It has been determined that faba bean condensed tannins interact with dietary and endogenous proteins in pigs' digestive systems.

As a result, less food protein is really digestible and more endogenously secreted proteins are excreted. Faba bean tannins interact with proteins more frequently than other molecules.

learn more about Faba bean here

brainly.com/question/7053208

#SPJ4

You might be interested in
Unlike food webs, food chains
inessss [21]
C is correct. the rest is either about food webs or about both food webs and food chains.
8 0
3 years ago
if you want to conduct a research study about your favorite restaurant in town,what method of qualitative research is appropriat
iogann1982 [59]

Answer:

People that like the restaurant

Explanation:

In order to judge the feeling of the town, you should take into aspect what other people think of it, and since the people's numbers change, it would be good use to measure some aspects

7 0
3 years ago
Can someone please give me an example of a biodiversity law environmental science
masha68 [24]

Biodiversity is variety of life. Bio means life and diversity means change, different forms of life. The world constitute different species of plants and animals. Have a nice day!

5 0
3 years ago
Select the correct compound.
Leviafan [203]

Answer:

The oxygen atom is not balanced in the chemical reaction.

3 0
3 years ago
Read 2 more answers
Is it 0.05, 0.04, 0.15 and 0.80
LiRa [457]

Answer:

No

Explanation:

I have 0.04 cents, you have 0.05, Mom has 0.15, and dad has 0.80

6 0
2 years ago
Other questions:
  • Which idea is most directly related to lamarcks beliefs about evolution?
    15·2 answers
  • Natural lakes are formed by erosion. ALL BUT one of these is a type of erosion that forms lakes.
    8·2 answers
  • Which of the following describes a conclusion?
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • which scale is used to measure the intensity of a tornado?(saffir simpson scale,Fujita scale,Mercalli scale,richter scale?
    15·1 answer
  • . A world-class cyclist training for the Tour de France increases his respiration rate while pedaling up hills. What characteris
    12·1 answer
  • John’s grandparents make wine for special occasions. They add a pinch of yeast to crushed grapes. Over time, this action release
    8·1 answer
  • Answer all 3 parts of this essay question:
    15·1 answer
  • What is the correct order of a food chain containing the following organisms: quail (bird), desert shrub, coyote, snake?
    10·1 answer
  • Sam wished to investigate how fertilizer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!