1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
3 years ago
8

List at least two possible reasons for the differences you see between the pinch strength of the first two fingers and the secon

d two fingers. in your answer consider actions of the hand and musculature.
Biology
1 answer:
Radda [10]3 years ago
3 0
<span>Two possible reasons include the greater force exerted by the thumb's opposition to the forefinger and the greater musculature that radiates from the wrist to the first two fingers.</span>
You might be interested in
What is a dendrite and what does it do?
svlad2 [7]

A dendrite is an extension of a nerve cell. A dendrite receives impulses from other synapses and sent to the cell body.

8 0
4 years ago
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
How do sexual reproduction produce new plants?
gavmur [86]

Sexual reproduction in flowering plants involves the production of male and female gametes, the transfer of the male gametes to the female ovules in a process called pollination. After pollination occurs, fertilization happens and the ovules grow into seeds within a fruit.

8 0
3 years ago
Describe how DNA is protected in its cooled form
kap26 [50]

The DNA double helix coils around itself simply because it is the most stable way for the atoms to interact. In other words, the DNA molecule naturally is coiled because the chemical bonds are most stable in a helix. This is the primary structure of DNA.

8 0
3 years ago
What do all living things have? Check all that apply.entify Characteristics Sharedngs
belka [17]

Answer:

Cells

Explanation:

Living organisms all have cells

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these structures is a separate generation from the plant sporophyte?
    12·2 answers
  • All of the following are characteristics of organisms EXCEPT
    12·2 answers
  • A nurse educator for a local home care company is teaching staff nurses on the use of the Outcome and Assessment Information Set
    10·1 answer
  • PLZ HELP FOR BRANLIEST
    9·2 answers
  • How do sensory receptors send messages to the brain?
    10·1 answer
  • 34. If only one type of tree is planted in an abandoned<br>field, the ecosystem will​
    12·1 answer
  • Which organelle carries out cellaur respriation?
    9·1 answer
  • Why don’t eclipses occur during any other moon phases besides the new and full moon?
    12·1 answer
  • Most biology textbooks prior to 1990 listed the major function of ribonucleic acid (RNA) as transferring information from DNA to
    9·1 answer
  • What<br> sugar is found in an ATP molecule?<br> A. glucose<br> B. fructose<br> C. ribose
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!