A dendrite is an extension of a nerve cell. A dendrite receives impulses from other synapses and sent to the cell body.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Sexual reproduction in flowering plants involves the production of male and female gametes, the transfer of the male gametes to the female ovules in a process called pollination. After pollination occurs, fertilization happens and the ovules grow into seeds within a fruit.
The DNA double helix coils around itself simply because it is the most stable way for the atoms to interact. In other words, the DNA molecule naturally is coiled because the chemical bonds are most stable in a helix. This is the primary structure of DNA.
Answer:
Cells
Explanation:
Living organisms all have cells