1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EleoNora [17]
1 year ago
12

The ___________ is a quarantine area where all removed files, virus infected or suspicious, are stored until you take action on

them.
Biology
1 answer:
Alenkinab [10]1 year ago
6 0

The <u>virus vault</u> is a quarantine area where all removed files, virus infected or suspicious, are stored till you take action on them.

<h3>What is a virus vault?</h3>

All quarantine files, whether they are suspicious or contaminated with a virus, are kept in the Virus Vault, a virus quarantine. Since every file is encrypted, it cannot harm your machine.

The Virus Vault's primary function is to retain any deleted file for a predetermined amount of time so that you can confirm you don't need it anymore. You can send the missing file for examination, attempt to fix it, and then return it to its original position if you discover that it is the cause of the issues.

By selecting numerous items in the list and clicking the corresponding button, you can Restore or Restore as multiple items at once. If some of the chosen objects cannot be properly restored, they will still be highlighted in the list.

Learn more about quarantine files

brainly.com/question/20595461

#SPJ4

You might be interested in
What will occur when the following chemical reaction reaches dynamic
N76 [4]

Answer: A

Explanation:

I'm 60% sure

3 0
3 years ago
Read 2 more answers
Trawling adversely affects marine life zones because it introduces invasive species into the environment. true false
USPshnik [31]
The correct answer, I believe is false. 
6 0
3 years ago
Read 2 more answers
Use Meteorology in a Sentence science related answers only please
alex41 [277]

Meteorology is the science of the weather. The weather person on the TV is a meteorologist.

Some of them quite liked meteorology, but others only tolerated it as it is not an exact science

7 0
3 years ago
The single largest portion of the human genome consists of noncoding _______, some of which include ______. These are DNA segmen
yuradex [85]

Answer:

Repetitive DNA segments: transposable elements.

I hope it helps.

8 0
3 years ago
Why is uncoating in an animal needed
kozerog [31]

Answer:

Since almost all DNA viruses replicate in the nucleus of infected cells, they must be targeted there. In many cases the entire nucleocapsid enters the nucleus, where uncoating then takes place. In order for new virus to be assembled, both new viral genomes and other virion components (proteins) must be produced.

Explanation:

8 0
3 years ago
Other questions:
  • If a company developed a way to modify a person’s DNA to guarantee certain attributes in offspring, should that company be force
    7·2 answers
  • Playing music is an ____ trait
    5·1 answer
  • Can some one help me out please
    11·1 answer
  • Fill in the chart each creature
    6·1 answer
  • Which of the following statements is NOT part of the Cell Theory?
    8·2 answers
  • In peas, the allele for yellow seeds (Y) is dominant to the allele for green seeds (y). What would be the genotype and phenotype
    5·1 answer
  • Can you help me i will give you a branlist
    5·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Animals eat these plants and pass the phosphorus through the food chain
    10·1 answer
  • 1.write the chemical equation for transpiration
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!