In the Canadian territory, Nunavut.
Answer:The main way animal-like protists differ from plant-like protists is in the way they get energy. Animal-like protists are heterotrophs. ... Plant-like protists, on the other hand, are autotrophs. They can make their own energy from the sun or other sources just as plants can.
Explanation:
Answer: 3 stages- glycolysis, pyruvate oxidation, the citric acid or Krebs cycle, and oxidative phosphorylation. In glycolysis, the beginning process of all types of cellular respiration, two molecules of ATP are used to attach 2 phosphate groups to a glucose molecule, which is broken down into 2 separate 3-carbon PGAL molecules. PGAL releases electrons and hydrogen ions to the electron carrier molecule NADP+. A carboxyl group is removed from pyruvate and released as carbon dioxide. The two-carbon molecule from the first step is oxidized, and NAD+ accepts the electrons to form NADH. The oxidized two-carbon molecule, an acetyl group, is attached to Coenzyme A to form acetyl CoA. The citric acid cycle, where acetyl CoA is modified in the mitochondria to produce energy precursors in preparation for the next step. Oxidative phosphorylation, the process where electron transport from the energy precursors from the citric acid cycle (step 3) leads to the phosphorylation of ADP, producing ATP. The space between the inner and outer membrane is called the intermembrane space. The space enclosed by the inner membrane is called the matrix. The second stage of cellular respiration, the Krebs cycle, takes place in the matrix. The third stage, electron transport, takes place on the inner membrane.
Explanation:
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
