1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solong [7]
1 year ago
7

List the muscles (medical term) for each of the biomechanical roles for the movement of kicking a soccer ball.

Health
1 answer:
Greeley [361]1 year ago
6 0

Given what we know, we can confirm that the muscles for each of the biomechanical roles for the movement of kicking a soccer ball are the quadriceps (agonist) rectus femoris (assistant mover), triceps surae (antagonist) and tibialis anterior (stabilizer).

<h3>What are the biomechanical roles for the movement of kicking a soccer ball?</h3>

In the movement of kicking the ball the muscle mainly involved will be the quadriceps (agonist) in conjunction with the hip extensors, primarily the rectus femoris. At the same time, the triceps surae and the tibialis anterior will do an isometric contraction to give more stability to the movement.

Therefore, we can confirm that the muscles for each of the biomechanical roles for the movement of kicking a soccer ball are the quadriceps (agonist) rectus femoris (assistant mover), triceps surae (antagonist) and tibialis anterior (stabilizer).

To learn more about biomechanical roles visit: brainly.com/question/15328903?referrer=searchResults

#SPJ1

You might be interested in
Carol is restless during class because her professor's distressed facial expressions lead her to believe that he dislikes teachi
8_murik_8 [283]

Answer:

the fundamental attribution error

Explanation:

The fundamental atribution error, also called attribution biased is basically an error made by people and studied by psycology in which people read other persons based on their own experiences and attributes and attribute them to the persons attitude and what they are thinking and doing.

5 0
4 years ago
Which short-term consequences of sleep deprivation is a student likely to encounter? Check all that apply.
alexandr1967 [171]

Answer:  falling asleep in class

missing assignments

low test scores

lack of concentration  i think

Explanation:

8 0
3 years ago
Read 2 more answers
A person's BAC will go down if they
bija089 [108]
In order to lower BAC, you need to do some things that excrete the alcohlic substance from your system through normal metabolic process (throwing up IS NOT included) or lower the absorption rate of the alcohol
Such as eating more calorie dense food such as bread or crackers, Produce sweats through physical activities.
8 0
3 years ago
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
If fat malabsorption causes calcium in the small intestine to bind to fatty acids or bile acids instead of oxalates, plant compo
marin [14]

Answer:

kidney stones

Explanation:

people with high oxalate diets are more prone to developing health problems, including kidney stones.

6 0
3 years ago
Other questions:
  • Jeff is one of the biggest pill pushers in our high school. Yesterday he offered you some of his brother's ADHD medication as a
    6·1 answer
  • What organs are involved in the changing of blood pressure and heart rate during physical exercise? *
    9·1 answer
  • What are the advantages and disadvantages involved with collecting payment at the time of service?
    12·1 answer
  • Can someone write a two sentence definition of the meaning OCD . Please do not copy off of google . Use your own words :) .
    7·2 answers
  • A nurse is developing a teaching plan for a client with a history of a myocardial infarction (MI). The client requests informati
    14·2 answers
  • Salts and sugars work to preserve foods by creating a
    11·1 answer
  • If two brown-eyed people have a blue-eyed child, we can deduce which of the following? A. The gene for blue eyes is sex-linked.
    13·1 answer
  • Which of the following best describes what alveoli are
    13·2 answers
  • Yaha hamare frndss or yaha hamari pawari hoo rhi h​
    8·1 answer
  • Anders has just received devastating news about the coffee shop he owns. Things seem very bleak because a nationally known compe
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!