1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnZ [28]
2 years ago
9

the hypothalamus group of answer choices helps transform new memories into long term memories. permits the two hemispheres of th

e brain to communicate with each other. regulates motor coordination, movement and balance. regulates the pituitary gland and also controls eating and drinking.
Biology
1 answer:
Dmitriy789 [7]2 years ago
4 0

Answer:

regulates motor coordination, movement and balance

Explanation:

See https://my.clevelandclinic.org/health/articles/22566-hypothalamus

You might be interested in
Describe two patterns of complex inheritance and explain how they are different from Mendelian patterns. I will give you Brainli
Alex Ar [27]

Answer:

Two patterns of complex inheritance are a color-blind male and flowers and when there is a color-blind male and a normal female.

Explanation: One of the Mendelian laws states that there is a dominant and a recessive gene. If these are together and form heterozygote only the dominant allele will be shown.

8 0
3 years ago
A student sets up an experiment with two groups of bacteria. One group is exposed to the normal amount of mercury found in the e
Dominik [7]
The Answer Should Be Answer C. Variable Group.
6 0
3 years ago
Read 2 more answers
PLZ HELP MEEEEEE
sladkih [1.3K]

Answer:

Quick answer: Cold front

Explanation:

Cold fronts are less likely to be humid and carry rain clouds. Hope this can help you!

3 0
2 years ago
Read 2 more answers
How do humans regulate water levels in the body?​
pentagon [3]

Answer:

Body water homeostasis is regulated mainly through ingested fluids, which, in turn, depends on thirst. Thirst is a sensation created by the hypothalamus, the thirst center of the human body.

Explanation:

6 0
2 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
Other questions:
  • What does he lac Operon in bacteria code for
    15·1 answer
  • There is antibody-mediated and cell-mediated specific immunity. Which type of cells are primarily involved in the antibody-media
    12·1 answer
  • Question 1(Multiple Choice Worth 4 points)
    11·2 answers
  • How have humans caused damage and change to each of the earths spheres
    7·1 answer
  • In the Kirby-Bauer disk diffusion test, the _______ of the zone of inhibition is measured and used for interpretation.
    6·1 answer
  • A basic understanding of which field of science, and its related technology, is essential for the both Kepler spacecraft and for
    8·2 answers
  • The earth is considered to be in the Goldilocks zone.why?
    15·1 answer
  • How many alleles are typically present in a genotype?
    11·1 answer
  • How does a wind turbine produce electricity?
    14·1 answer
  • What is a sea anemone?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!