1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SCORPION-xisa [38]
2 years ago
5

The ecological model relies upon an assessment that documents specific background information as a means to understand a child's

behavior. what is the primary focus of that assessment?
Biology
1 answer:
Alexandra [31]2 years ago
5 0

The ecological model relies upon ecological assessment to gather information about the child's behaviour and expectations relative to the child's ecosystems in which the child functions.

  • Ecological assessments are a kind of assessment used with students with special needs to see how they perform in different settings.  check the various particularities of special education, and find out how ecological assessments help students with special needs and what is an Individualized Education Program
  • An ecological assessment may be a comprehensive process in which data is collected about how a child functions in different environments or settings. Sometimes, students eligible for education perform or behave well in some environments but have difficulty in others. for instance , at school, a student could also be calm during class time but is always upset in the cafeteria.
  • A child's behaviour was normal during math and science class but could act very inappropriately during language and art. Other children even have social phobia , which is an irrational, persistent fear of visiting school. These children seem fine reception but consistently become anxious, depressed, or scared whenever they have to go to school.

To learn more about child's ecosystems:

brainly.com/question/20527290

#SPJ4      

     

You might be interested in
Which type of rock does NOT belong in the same category as the others?
gulaghasi [49]
Slate, Skarn, Marble, and Quartzite are Metamorphic Rocks. 
BUT SKARN is the type of rock that does not belong in the same category as the others.

Slate metamorphosed from mudstone. Marble metamorphosed from limestone. Quartzite metamorphosed from sandstone. All these rocks retain their solid forms.

Skarn<span> is a metasomatic rock composed of calc-silicate minerals. Skarn is formed at the contact zone between carbonate rocks and silicic magma. Skarn is often rich in hydrothermal ore minerals.</span> Skarn as a metamorphic rock is dissolved under metasomatic process and hardens back into a rock.

3 0
3 years ago
These structures are very large, blunt, irregularly shaped processes. The only examples in the human body are on the femur. What
RoseWind [281]

Answer:

Trochanter

Explanation:

The trochanter is a lateral projection of the femur (the longest bone in the human body) in the upper part of the thigh, that is, an irregular and large prominence of the femur. The greater trochanter is a prominent and relatively easy to palpate structure belonging to the femur, and serves as an insertion to many muscles that participate in the movement and stability of the hip. The lesser trochanter is less prominent and impossible to palpate due to its internal situation, it serves as an insert for some muscles such as the iliac psoas, one of those in charge of hip flexion.

5 0
3 years ago
When CpG islands are unmethylated, ________.
agasfer [191]
C is the answer bc it always been thought to me
3 0
3 years ago
Recessive genes mask other genes that are present. <br>True or false? ( Answer worth 25 points;)
balandron [24]
Hello!! I always remember recessive genes as someone having a passive personality and dominant genes as having an assertive personality. Therefore, dominant genes would mask others when present because they have that assertive personality. If you think about it as babies, when their dad has darker hair and the mother has lighter hair, the baby will most likely have darker hair because the darker hair is the dominant gene. I would say that the answer would be false. If you are having trouble understanding, you can always make a Punnett square and see what your outcomes are. I hope I helped. Have a great day!!
7 0
3 years ago
Read 2 more answers
Which of the following statements is not true about mRNA?
ASHA 777 [7]

Answer:

The correct answer is d. eukaryotes almost always produce polycistronic mRNA

Explanation:

mRNA can be polycistronic or monocistronic. A monocistronic mRNA contains the information of one gene only so a monocistronic mRNA code only one protein at a time but a polycistronic mRNA can code for multiple proteins at a time.

In eukaryotes, one transcriptional unit carries the information of only one protein so eukaryotes produce monocistronic mRNA but some eukaryotes are capable of having polycistronic mRNA.

In prokaryotes, many genes are transcribed as a unit to produce multiple proteins so prokaryotes produce polycistronic mRNA. Therefore the statement which is not true is d. eukaryotes almost always produce polycistronic mRNA.

3 0
4 years ago
Other questions:
  • make a decision about the molecule nahco3 classification as organic or inorganic. In two or more complete sentenced state and de
    10·2 answers
  • What do you think is the reason why plant life is unable to grow on the shores of Lake Powell?
    6·1 answer
  • Antarctica can be classified as arid as well as polar. Explain.
    7·1 answer
  • No matter which biome we examine, there is ALWAYS one group of organisms that is the nonmobile base for the biome's food web: th
    13·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Which domain does sulfolobus belong to​
    13·1 answer
  • Fill the blanks to complete this passage about geologic processes
    12·2 answers
  • When mendel crossed a true-breeding short plant with a true-breeding tall plant, all of the offspring were tall. which term desc
    9·1 answer
  • Am an evil halo they said I'm a devil that's why I accept that I'm a devil​
    9·2 answers
  • In a neuroscience experiment, which one of these would best indicate LTP?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!