D because all your veins ate nearly in your heart and if your heart stops they stop too
Answer:
<em>The correct option is B) 5-10%</em>
Explanation:
We have seen and depicted various scenarios where we see how different changes arise and dominate the world. Social scientists suggest that as low as 5-10% people of a population are enough to bring about a change because people tend to copy what others are doing. Same goes for countries of the world. Each new popular technique which is learnt by one country tends to become popular and learnt by other countries. For example, the usage of a social app starts with a few members of a population using it and with time it becomes popular in the whole world.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
I believe it’s the first, third and fourth ones. I might be wrong and I’m sorry if I am.
Because the world rotates around and God the creator changed up the earth that's the biblical answer but a scientific answer would be due to himans