1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anon25 [30]
2 years ago
14

E effect of beneficial microbes of normal biota against invading microbes is called:______.

Biology
1 answer:
Lorico [155]2 years ago
4 0

The effect of beneficial microbes of normal biota against invading microbes is called microbial antagonism.

<h3>What is the name of the effect of beneficial microbes of normal biota against invading microbes?</h3>

  • Living entities that are too small to be seen by the normal eye are referred to as microbes or microorganisms. They primarily consist of bacteria and fungus, which are single-celled organisms.
  • The conflict between microbial species over food sources and territory is known as microbial antagonism.
  • The normal bacterial flora of the body acts as a defence against pathogens through microbial conflict. As a result, if one organism outcompetes another, the organism that was unable to flourish in the environment will be inhibited.
  • Since many of the bacteria that live in our intestines are antagonistic to pathogens, antagonism may be fueled by mechanisms like the manufacture of antibiotics or competition, and it frequently aids people in avoiding intestinal illness.

To learn more about microbial antagonism refer to:

brainly.com/question/21799278

#SPJ4

You might be interested in
What effect would constriction of the blood vessels have on the body?
zheka24 [161]
D because all your veins ate nearly in your heart and if your heart stops they stop too
3 0
3 years ago
Research by social scientists suggests that it takes ____ percent of the population of a community, country, or the world to bri
Lady bird [3.3K]

Answer:

<em>The correct option is B) 5-10%</em>

Explanation:

We have seen and depicted various scenarios where we see how different changes arise and dominate the world. Social scientists suggest that as low as 5-10% people of a population are enough to bring about a change because people tend to copy what others are doing. Same goes for countries of the world. Each new popular technique which is learnt by one country tends to become popular and learnt by other countries. For example, the usage of a social app starts with a few members of a population using it and with time it becomes popular in the whole world.

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Please help thank you
Bingel [31]
I believe it’s the first, third and fourth ones. I might be wrong and I’m sorry if I am.
8 0
2 years ago
Why does the designed world change?
RSB [31]
Because the world rotates around and God the creator changed up the earth that's the biblical answer but a scientific answer would be due to himans
5 0
3 years ago
Other questions:
  • Which type of rna brings the information in the genetic code from the nucleus to the ribosomes of the cell? *?
    13·1 answer
  • 2.   When an animal receives a vaccine, about how long will it take before the animal's immune system will protect the animal fr
    15·2 answers
  • Pyrolobus fumarii, an extreme thermophile, can survive at a temperature as high as 113 C. This microorganism could be categorize
    13·1 answer
  • Genes are located in which part of the cell
    14·2 answers
  • A scientist is comparing the outer layer of an onion celk to the outer layer of a human skin cell. What is unique about the oute
    7·1 answer
  • Which of the following pairs is not a correct monomer/polymer pairing?
    10·1 answer
  • 1pt Which of the following life processes is not necessary for an individual organism to survive, but is necessary for the survi
    15·1 answer
  • How are all cells similar?
    10·2 answers
  • 6. One of the bacteria in Model 1 has a tail-like structure.
    13·1 answer
  • I will give u brainliest please help
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!