1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
diamong [38]
3 years ago
13

Which organelle should be listed under “Both” in the diagram?

Biology
2 answers:
Olin [163]3 years ago
7 0
The answer is mitochondrion
slega [8]3 years ago
5 0
B mitochondrion is the correct answer
You might be interested in
What is the main function of carbohydrates in living organisms
Minchanka [31]
Mainly carbohydrates our body stored energy as glycogen.
3 0
3 years ago
Does the number of particles change as a substance changes it’s state?
JulsSmile [24]

Answer:

No

Explanation:

Only what state it is in, soild, liquid or gas. Particals never change duering this.

6 0
3 years ago
Why does red pepper flakes make mold grow faster on foods?
lidiya [134]

Answer:

Because it is proccessed

Explanation:

And has preservatives

5 0
2 years ago
Read 2 more answers
The plasma membrane exhibits selective permeability. this means that __________.
antoniya [11.8K]
This means that it only allows for select materials to be able to move across it and not all molecules and other substances floating in the external environment. The proteins and the phospholipid Bilayer help to contribute the selectivity of the membrane.
7 0
3 years ago
An adult with the diagnosis of schizophrenia is admitted to the psychiatric hospital. the client is ungroomed, appears to be hea
Igoryamba
<span>If an adult with the diagnosis of schizophrenia is admitted to the psychiatric hospital during the first few hospital days the nurse should seek out the client frequently in order to spend short periods of time together. Seeking out the client frequently to spend short periods of time together will help the nurse establish trust without increasing the person's anxiety. Seeing that the client bathes and changes clothes daily is not a priority unless the client is super and extremely dirty; this client is ungroomed, not dirty. A withdrawn client will usually not approach anyone and the client's history reveals a failure to speak.</span>
8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How is meiosis different from mitosis?
    13·2 answers
  • Can someone help me with these
    12·1 answer
  • What is the cellular process of sexual reproduction
    15·1 answer
  • How does the warming of oceans impact ecosystems
    10·1 answer
  • Which of these methods that aids in the movement of ions or molecules across a cell membrane requires the use of energy which is
    13·1 answer
  • ¿Pueden dos terremotos de igual magnitud provocar daños muy diferentes? ¿Cómo?
    15·1 answer
  • As opposed to protists, all plants are
    15·1 answer
  • Which of the following cell structures is found in plant cells but not in animal cells?
    10·1 answer
  • In Figures 1 and 2 above, label the A-bands, I-bands, and H-zones. Measure
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!