1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MariettaO [177]
1 year ago
13

Turtles Ahoy! (A real implementation of the scientific method) Did you ever wonder how baby sea turtles can run down into the oc

ean after hatching, paddle thousands of miles across the North Atlantic, and find their way back years later to the same beach they were born? Curious about these creatures, a biologist at University of North Carolina at Chapel Hill has discovered at least part of the answer. Baby loggerhead turtles, no bigger than a child's hand, use the Earth's magnetic fields and waves to orient themselves and direct their marathon swims. In a recent issue of Scientific American magazine, biologist Kenneth Lohmann describes experiments showing their biological compass. Working with Florida Atlantic University science researchers, Lohmann tied loggerhead turtle hatchlings (newborns) to a device and placed them in a large glass tank filled with water. Within minutes of placing the hatchlings in total darkness, researchers observed that the turtles all swam in the same direction. In fact, most of them swam towards points located between magnetic north and east, directions that would lead them away from Florida's east coast and toward the Gulf Stream currents. The biologists also found that when they reversed the magnetic field, the turtles swam in the opposite direction- toward the southwest. 1. Circle and label the question that is going to be investigated. 2. What is the hypothesis? 3. What is the independent variable? 4. What is the dependent variable? Dood 5. What are the constants? 6. Describe the data and analysis. 7. What is the conclusion?​
Biology
1 answer:
lord [1]1 year ago
5 0

The scientific method is a research method that involves the question and problem definition, hypothesis formulation, goals, defining variables, collecting data and analysis, discussion, and conclusion.

<h3>What are the steps of the scientific method?</h3>

There are different steps to follow in a scientific method

  • Previous knowledge about the study object.
  • Definition and problem statement. The question for which there is no answer yet. A question the investigator wants to answer.
  • Goal especification. The goal is what the investigator wants to know.
  • Hypothesis formulation. The researcher hypothesizes in order to predict what is going on or what is expected to occur.
  • Experiment. Different variables influencing the proyect are considered. Data collection and analysis stages. This step involves testing the observations.
  • Results
  • Discussion and hypothesis verification. This step involves the deriving of the working hypothesis.
  • Conclusions.

<h3>What is a hypothesis?</h3>

A hypothesis is a scientific conjecture, not verified, that requires corroboration. It must be objective. Usually, it is written in the present time.

It is a claim of how it works a relationship between two or more variables. There must be a logical relationship between the involved variables.

<h3>What are dependent and independent variables?</h3>

When conducting an experiment, we must always consider the involved variables.

  • Independent variables are those modified or changed by the researcher to study how this change affects another variable and hence the results. This variable is not affected by any other one but influences or causes a reaction in other variables.

  • The dependent variable is the one influenced by the independent variable, and is affected by any change on this last one. Its response might be either directly proportional or inversely proportional to the change in the independent variable.

In the exposed example,

1. <em>Circle and label the question that is going to be investigated</em>.

How can sea turtles orientate into the ocean after hatching, paddle thousands of miles across the North Atlantic, and find their way back years later to the same beach they were born?

2. <em>What is the hypothesis</em>?

Turtles use Earth's magnetic fields and waves to orientate themselves in the water and on the ground.

3. <em>What is the independent variable</em>?

The magnetic field orientation.

4. <em>What is the dependent variable</em>?

Direction in which the turtles swim.

5. <em>What are the constants</em>?

Large glass tank filled with water and total darkness.

6. <em>Describe the data and analysis</em>.

Data,

  • Under normal magnetic field, the turtles swam towards the notheast.
  • Under reversed magnetic field, the turtles swam toward the southwest.

Analysis,

Turtles follow magnetic north and east, even when the magnetic field orientation is reversed.

7. <em>What is the conclusion</em>?​

The hypothesis is accepted. Turtles use Earth's magnetic fields to orientate themselved moving between the magnetic north and east.

You can learn more about the scientific method at

brainly.com/question/8483218

brainly.com/question/16172865

brainly.com/question/7508826

#SPJ1

You might be interested in
What is a group of tissue that work together to do a specific job?
zimovet [89]
The group of tissue that work together to do a specific job is called ORGAN
3 0
3 years ago
What type of spider is this and how deadly is it 1/10?
expeople1 [14]

In my opinion that would be a wolf spider. I will check online to see for you :)

Wolf spiders deadly:3/10

Cant hurt humans

Causes rash or itching

3 0
3 years ago
Read 2 more answers
Which type of RNA is used to carry the amino acids to the site of protein synthesis for translation?
d1i1m1o1n [39]

Answer:

D.) tRNA

Explanation:

tRNA-(Transfer RNA)  molecules carry amino acids to the ribosomes during protein synthesis.

A Cell's Ribosomes-(Basically the structures of when synthesis takes place)

<em>Hoodmemes~</em>

6 0
3 years ago
What are invasive species?
Vladimir [108]

Answer:

B. Nonnative species that are superior competitors.

Explanation:

As you might have learned, an invasive specie is not native to a certain location but might show troublesome to an ecossystem and it may also damage the environment.

8 0
3 years ago
In mitochondrial electron transport, what is the direct role of o2
Lady_Fox [76]
The answer is to function as the final electron acceptor in the electron transport chain. It is the only place that O2 partakes in the cellular respiration is at the end of the electron transport chain as the final electron acceptor. Oxygen's high affinity for electrons safeguards its success in this role. Its assistances to driving electron transport, forming a proton gradient, and synthesizing ATP are all indirect effects of its role as the terminal electron acceptor.
7 0
3 years ago
Other questions:
  • The overall amount of water on our planet has remained about the same for two billion years.true or false
    10·1 answer
  • What are properties of clay soils? Cheak all that apply.
    7·2 answers
  • Five steps of doing an experiment
    12·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Most areas near the equator receive ___ solar energy than the poles receive<br> -more<br> -less
    15·1 answer
  • Sulfa antibiotics damage bacteria by affecting a certain bacterial enzyme. The sulfa antibiotic looks similar to a substrate nor
    7·1 answer
  • Which of the following does not happen when a cell divides?
    10·1 answer
  • 1
    13·1 answer
  • During replication, the genetic material of an organism has developed an error which is now part of the genome in its gamete cel
    10·1 answer
  • Complete the chart by describing the function and structure in each cell
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!