1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
1 year ago
11

a human fetus develops at the mother’s body temperature. at birth, most newborns experience a drop in temperature, and their bod

ies must quickly do something about it. in fact what they do is the same thing a hibernating mammal does as it rouses itself from its winter "snooze." during hibernation, an animal’s body temperature is low. in order to move about and take care of itself once awake again, the animal that has been hibernating must raise its body temperature. (william k. purves et al., life: the science of biology) what is the primary pattern of organization in this passage? definition comparison classification sequence
Biology
1 answer:
Sloan [31]1 year ago
3 0

A human fetus develops at the mother’s body temperature. At birth, most newborns experience a drop in temperature, and their bodies must quickly do something about it. What they do is the same thing a hibernating mammal does as it rouses itself from its winter "snooze." During hibernation, an animal’s body temperature is low. In order to move about and take care of itself once awake again, the animal that has been hibernating must raise its body temperature. (William k. Purves et al., life: the science of biology) The definition is the primary pattern of organization in this passage.

This passage is explaining the process of hibernation and its importance in the animal life cycle.

To learn more about hibernation here

brainly.com/question/2594381

#SPJ4

You might be interested in
Which of the following is a way humans use trees? a. paper b. food c. wood d. all of the above
USPshnik [31]

Answer:

the answer is d

Explanation:

hope this helps! have a nice day * please mark brainliest *

7 0
3 years ago
Read 2 more answers
Extracting aluminum from ore takes 20 times more _____ than obtaining it from _____ sources
mamaluj [8]
Extracting aluminum from bauxite ore requires 20 times more energy than extracting it from aluminum from recycled sources so therefore that is a good reason to promote its recycling starting with pop and beer cans which are things that most of us use.
3 0
3 years ago
Plz help me outttttt
scoundrel [369]

B) The mutation is beneficial and allows those who have it to reproduce more than average.


If the mutation is beneficial, it will become common in a population since the individual(s) that have this beneficial mutation will survive longer to produce more offspring that have this mutation. These offspring will also live longer and spread this mutation through the gene pool through reproduction.


Hope this helps :)

3 0
3 years ago
Read 2 more answers
I NEED HELP QUICK, PLEASE !!
Fiesta28 [93]
I think the answer is C) R I had this question and that was right for me hope this helps!
3 0
4 years ago
At the end of glycolysis,_____,_____,________ are produced, What is the net yield of ATP?
Savatey [412]

Answer:

2pyruvates

net yield of ATP=2

Explanation:

6 0
3 years ago
Other questions:
  • Volcanic activity was more frequent in earths past then it is today <br><br> True or false
    15·1 answer
  • What type of "age" reveals the exact age of a species? ​
    14·1 answer
  • Organelle that manages or controls all the cell functions in a eukaryotic cell
    13·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of these is a sign that plants in a terrarium are transpiring?
    15·2 answers
  • What best describes the types of organsisms found in esturaries
    10·2 answers
  • Osmosis is the diffusion process that moves through their membranes from higher to lower concentration
    5·1 answer
  • Hello! Im looking for someone to answer this correctly this will mean a lot :)
    12·1 answer
  • On a sunny day at an open market a vendor, Ms. Milly, occasionally sprinkles water on her wilting lettuce. During the day Ms. Mi
    13·2 answers
  • This object is rocky or metallic and revolves around the sun. Which object is this describing in the solar system?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!