1 year ago

Organisms depend on , which are compounds that stabilize ph by absorbing or releasing h ions.

1 answer:

3 0

Organisms depend on buffer that are compounds that stabilize pH by absorbing or releasing h ions. It consists of weak acids and weak bases.

The buffer is also consists of undissociated acid (HA) and the ions that are made by dissociating the acid (A-). Because of the presence of weak acids and bases and to stabilize the pH the buffer absorb or give off H+.

The nucleic acids must have positive charge that helps in formation of double helices.

Undissociated acid means when an acid dissociates to release a proton to make the solution acidic.

To learn more about undissociated here

brainly.com/question/10979049

#SPJ4

You might be interested in

Serious systemic fungal infections and parasitic infections usually only develop in individuals who are

iren [92.7K]

Serious systemic fungal infections and parasitic infections usually only develop in individuals who are immunocompromised. These individuals have a weak immune system. The body cannot respond quickly to infections since their immunity is not very well developed.

5 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'